ID: 1192160582

View in Genome Browser
Species Human (GRCh38)
Location X:68783588-68783610
Sequence AGAAGCCGGCGGGCCGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192160575_1192160582 15 Left 1192160575 X:68783550-68783572 CCCTTCGAGGTGCTGAAGGCAGC No data
Right 1192160582 X:68783588-68783610 AGAAGCCGGCGGGCCGGCGTTGG 0: 1
1: 1
2: 0
3: 5
4: 96
1192160576_1192160582 14 Left 1192160576 X:68783551-68783573 CCTTCGAGGTGCTGAAGGCAGCG No data
Right 1192160582 X:68783588-68783610 AGAAGCCGGCGGGCCGGCGTTGG 0: 1
1: 1
2: 0
3: 5
4: 96
1192160574_1192160582 16 Left 1192160574 X:68783549-68783571 CCCCTTCGAGGTGCTGAAGGCAG No data
Right 1192160582 X:68783588-68783610 AGAAGCCGGCGGGCCGGCGTTGG 0: 1
1: 1
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192160582 Original CRISPR AGAAGCCGGCGGGCCGGCGT TGG Intergenic