ID: 1192161433

View in Genome Browser
Species Human (GRCh38)
Location X:68791131-68791153
Sequence GAATCTGCACTGATGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192161429_1192161433 19 Left 1192161429 X:68791089-68791111 CCTGCAAAGCTGTCTTTTGTGGG 0: 33
1: 249
2: 397
3: 387
4: 475
Right 1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG No data
1192161427_1192161433 20 Left 1192161427 X:68791088-68791110 CCCTGCAAAGCTGTCTTTTGTGG 0: 46
1: 251
2: 386
3: 383
4: 529
Right 1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192161433 Original CRISPR GAATCTGCACTGATGCAGCC AGG Intergenic
No off target data available for this crispr