ID: 1192162296

View in Genome Browser
Species Human (GRCh38)
Location X:68797528-68797550
Sequence ACCCACACCTCAGCTAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192162293_1192162296 8 Left 1192162293 X:68797497-68797519 CCTGGAAGATCTCTGGACTGGCT No data
Right 1192162296 X:68797528-68797550 ACCCACACCTCAGCTAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192162296 Original CRISPR ACCCACACCTCAGCTAGAAT GGG Intergenic
No off target data available for this crispr