ID: 1192162885

View in Genome Browser
Species Human (GRCh38)
Location X:68801889-68801911
Sequence GAAGTGTGAGGTCCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192162882_1192162885 12 Left 1192162882 X:68801854-68801876 CCTGCAGTAGGTGTTGTAAAGAT No data
Right 1192162885 X:68801889-68801911 GAAGTGTGAGGTCCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192162885 Original CRISPR GAAGTGTGAGGTCCCCTGCC AGG Intergenic
No off target data available for this crispr