ID: 1192163001

View in Genome Browser
Species Human (GRCh38)
Location X:68802657-68802679
Sequence TAGGCTGCAGATATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192162993_1192163001 11 Left 1192162993 X:68802623-68802645 CCAGGGCAAGGATACTGTCTCAT No data
Right 1192163001 X:68802657-68802679 TAGGCTGCAGATATGGAACTGGG No data
1192162992_1192163001 12 Left 1192162992 X:68802622-68802644 CCCAGGGCAAGGATACTGTCTCA No data
Right 1192163001 X:68802657-68802679 TAGGCTGCAGATATGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192163001 Original CRISPR TAGGCTGCAGATATGGAACT GGG Intergenic
No off target data available for this crispr