ID: 1192166222

View in Genome Browser
Species Human (GRCh38)
Location X:68829231-68829253
Sequence CTGTCCGGGGGCGCGTAGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192166217_1192166222 -6 Left 1192166217 X:68829214-68829236 CCGCGCTGAAGTAGAAGCTGTCC 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1192166222 X:68829231-68829253 CTGTCCGGGGGCGCGTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 67
1192166212_1192166222 23 Left 1192166212 X:68829185-68829207 CCCGCTCTTCTAAGTACACTGAG 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1192166222 X:68829231-68829253 CTGTCCGGGGGCGCGTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 67
1192166211_1192166222 24 Left 1192166211 X:68829184-68829206 CCCCGCTCTTCTAAGTACACTGA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1192166222 X:68829231-68829253 CTGTCCGGGGGCGCGTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 67
1192166216_1192166222 -5 Left 1192166216 X:68829213-68829235 CCCGCGCTGAAGTAGAAGCTGTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1192166222 X:68829231-68829253 CTGTCCGGGGGCGCGTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 67
1192166213_1192166222 22 Left 1192166213 X:68829186-68829208 CCGCTCTTCTAAGTACACTGAGC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1192166222 X:68829231-68829253 CTGTCCGGGGGCGCGTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192166222 Original CRISPR CTGTCCGGGGGCGCGTAGCC CGG Exonic