ID: 1192166809

View in Genome Browser
Species Human (GRCh38)
Location X:68831690-68831712
Sequence ATGCAGCTCCACAGCTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 761}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192166806_1192166809 13 Left 1192166806 X:68831654-68831676 CCTAATTGCTCTCTCGGGTCTCT 0: 1
1: 0
2: 1
3: 11
4: 166
Right 1192166809 X:68831690-68831712 ATGCAGCTCCACAGCTGGAAAGG 0: 1
1: 0
2: 0
3: 32
4: 761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192166809 Original CRISPR ATGCAGCTCCACAGCTGGAA AGG Intronic
901060175 1:6468227-6468249 GGGCAGCTCAACAGCTGGACAGG + Exonic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901959972 1:12818649-12818671 ATGCAGCTCCTCACCAGCAATGG - Intergenic
902197267 1:14806962-14806984 ATGCAGATCCCTAGCTGCAAGGG - Intronic
903503718 1:23817687-23817709 ATGCAGCTTCTCACCTGAAAAGG + Intronic
903784949 1:25854282-25854304 ATGAAGCTCCACCTCTTGAAGGG + Intronic
904364097 1:29999603-29999625 CTGCACCTCCACAGCTGGGGTGG - Intergenic
904433088 1:30477765-30477787 AGGCAGCACCAGAGCTGGGACGG + Intergenic
904463078 1:30692083-30692105 ATGTGGCGCCAGAGCTGGAAAGG + Intergenic
905455272 1:38084112-38084134 ATTCTGCTCCAGAACTGGAAGGG - Intergenic
906755723 1:48312658-48312680 ATGCAGCTCCTCACCAGCAACGG + Intronic
907005533 1:50909914-50909936 ATGCAGCTCCTCACCAGCAACGG - Intronic
908178289 1:61578414-61578436 ATGCAGCTCCTCACCAGCAATGG - Intergenic
908637985 1:66189864-66189886 ATGCAGCTCCTCACCAGCAATGG - Intronic
908726359 1:67181663-67181685 ATGCAGCTCCTCACCAGCAATGG - Intronic
909307185 1:74096578-74096600 ATGCAGCTCCTCACCAGCAATGG - Intronic
910111598 1:83689523-83689545 ACGCAGCTCCTCAACTGCAACGG - Intergenic
910339251 1:86167374-86167396 ATGCAGCTCCTCACCAGCAATGG - Intergenic
910699843 1:90062318-90062340 ATGCAGCTCCTCACCAGCAACGG - Intergenic
910715140 1:90222454-90222476 GTGCAGCTCCAGAGCTAGCAAGG - Intergenic
910974562 1:92892612-92892634 ATGCAGCTCCTCACCAGCAATGG + Intronic
911891571 1:103378302-103378324 ATGCAGCTCCTCACCAGCAAAGG + Intergenic
912775553 1:112504407-112504429 ATCCAGCTCCAAACCAGGAAAGG - Intronic
913607821 1:120481810-120481832 ATGCAGCTCCGCACCAGCAATGG + Intergenic
914208608 1:145558346-145558368 ATGCAGCTCCTCACCAGCAATGG - Intergenic
914583371 1:149040030-149040052 ATGCAGCTCCGCACCAGCAATGG - Intronic
915644148 1:157255036-157255058 ATGCAGCTCCTCACCAGCAATGG + Intergenic
915769879 1:158409584-158409606 ATGCATGTCTAGAGCTGGAAGGG - Intergenic
916221523 1:162449268-162449290 ATGCAGCTCCTCACCAGCAATGG + Intergenic
916248396 1:162710871-162710893 ATGCACCTCCCCTGCAGGAAAGG - Intronic
916543748 1:165783038-165783060 ATGCAGCTCCTCACCAGCAACGG - Intronic
916580347 1:166101300-166101322 ATGCAGCTCCTCACCAGCAATGG + Intronic
916723192 1:167500886-167500908 AGGCAGCCACACAGCTGGGATGG - Intronic
917398394 1:174618751-174618773 ACGCAGCTCCTCAGCAGCAATGG + Intronic
917532925 1:175853158-175853180 AGGCAGCTCCAGGGCTGGAATGG + Intergenic
917678598 1:177343394-177343416 ATCCAGGGCCACAGCTGCAAAGG - Intergenic
918094036 1:181319956-181319978 ATGAAGCTCCACTCCAGGAATGG - Intergenic
918209031 1:182334439-182334461 GGGCAGCTTCACATCTGGAAGGG + Intergenic
918434095 1:184493549-184493571 ATGCATATCTATAGCTGGAAGGG - Intronic
918517934 1:185383628-185383650 ATGCAGCTCCTCACCAGCAACGG - Intergenic
918973282 1:191447810-191447832 ATGCAGCTCCTCACCAGCAATGG - Intergenic
919468422 1:197949811-197949833 ATGTGGGTCCACAGATGGAAGGG - Intergenic
919654788 1:200186462-200186484 ATGCAGCTCCTCACCAGCAATGG + Intergenic
919811311 1:201410545-201410567 ATGCCCCTCCCCAGCTGGTAAGG + Intronic
920955366 1:210615468-210615490 ATGCAGCTCCTCACCAGCAATGG - Intronic
921184677 1:212659117-212659139 ATGCAGCTCCTCACCAGCAACGG + Intergenic
921842236 1:219840434-219840456 ATGCAGCTCCTCACCAGCAACGG + Intronic
921846426 1:219887804-219887826 ATGCAGCTCCTCACCAGCAACGG + Intronic
922671480 1:227511283-227511305 ATGCAGCTCATCAGTTGAAAAGG + Intergenic
923630175 1:235644565-235644587 ATGCAGCCCCACAGCTGCCGGGG + Intronic
924411296 1:243808141-243808163 ACGCAGCTCCTCACCAGGAACGG + Intronic
924462498 1:244271911-244271933 ATTGAGCTCTAAAGCTGGAAAGG - Intergenic
1064901034 10:20296439-20296461 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1064923493 10:20544029-20544051 CTGCAGCTCAATAACTGGAAAGG + Intergenic
1065055031 10:21835438-21835460 ATGCAGCTCCTCACCAGCAAGGG + Intronic
1065081082 10:22130354-22130376 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1065222479 10:23510957-23510979 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1065237753 10:23671460-23671482 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1065472968 10:26102432-26102454 ATGCAGCTCCTCACCAGCAACGG - Intronic
1065695813 10:28378920-28378942 ATGCAGCTCCTCAGGTGGCGAGG + Intergenic
1065838450 10:29680275-29680297 ATGCACCTCCACTGGTGGGACGG - Intronic
1066294306 10:34040994-34041016 ATGCAGCCACACAGCAGGGAAGG + Intergenic
1066936313 10:41842675-41842697 ATGCAGCTTCACACCAGCAATGG - Intergenic
1067335892 10:45363134-45363156 ATGCAGTTCCTCACCAGGAATGG + Intergenic
1067703017 10:48587256-48587278 ATGCAGCCCCAACCCTGGAAAGG - Intronic
1067903213 10:50263491-50263513 ATGCAGCTCCTCAGCAGCAATGG + Intergenic
1068065725 10:52128267-52128289 ATGTTGCTCCAGAGCTGAAAAGG + Intronic
1068299474 10:55120141-55120163 ATTCACCTCCACAACTGGAGTGG - Intronic
1068538404 10:58266961-58266983 GTGCAGCTGCATAGCTGGAGGGG - Intronic
1069256234 10:66335260-66335282 ATGCAGCTCCTCACCAGCAATGG - Intronic
1069989874 10:72308646-72308668 CTCCAGCTCCACAGAGGGAAGGG + Intergenic
1070231520 10:74573033-74573055 ACGCAGCTCCTCAGCAGCAACGG - Intronic
1071166335 10:82811775-82811797 ATGCAGCTCCATGGCAGGGAAGG - Intronic
1071740703 10:88355244-88355266 ATGCAGCTCCTCACCAGCAACGG - Intronic
1072311886 10:94164666-94164688 ATGCAGCTCCTCACCAGCAACGG - Intronic
1072397828 10:95063669-95063691 ATGCAGCTCCTCACCAGCAACGG - Intronic
1072433638 10:95396076-95396098 ATGCAGCTGCACTGTGGGAAGGG - Intronic
1072573164 10:96676139-96676161 ATGTGGCTTCACAGCTGGCATGG - Intronic
1072901689 10:99413051-99413073 ATGCAGCTCCTCACCAGCAACGG + Intronic
1073192710 10:101663121-101663143 ATGCAGGGCCACATGTGGAATGG - Intronic
1073268359 10:102241626-102241648 CTGGAGATCCACAGCTGGAAAGG - Intergenic
1073384367 10:103111069-103111091 ATGCCTCTCCACAGCTGCAAAGG + Intronic
1073565642 10:104533705-104533727 ATGCAGCTGGAGATCTGGAAGGG - Intergenic
1074030810 10:109686596-109686618 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1074179332 10:111044236-111044258 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1075456547 10:122588640-122588662 ATGGAGCTCCACAGCTCCAGAGG - Intronic
1075973850 10:126677421-126677443 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1076447170 10:130524630-130524652 ATGCAGACCCACCGCTGGAGTGG + Intergenic
1077591753 11:3497980-3498002 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1077783362 11:5356087-5356109 ATGCAGCTCCTCACCAGCAACGG + Intronic
1078224660 11:9381014-9381036 TTGCAGATCTACAGCTGGCATGG - Intergenic
1078419791 11:11200882-11200904 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1078674676 11:13399577-13399599 ATGCAGCTCCTCACCAGCAACGG - Intronic
1079161733 11:18001270-18001292 ATTAAGCTCCACATCTTGAAGGG - Intronic
1079177803 11:18158886-18158908 ATGCAGCTCCTCACCAGCAATGG + Intronic
1079232407 11:18659855-18659877 ATGCAGCTCCTCGCCAGGAATGG + Intergenic
1079516285 11:21273014-21273036 ATGCAGCTCCTCACCAGCAATGG + Intronic
1079865001 11:25723767-25723789 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1080093547 11:28377689-28377711 ATGCAGCTCCTCACCAGCAAAGG - Intergenic
1080253930 11:30268168-30268190 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1080291363 11:30674698-30674720 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1081087567 11:38821308-38821330 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1081599204 11:44480949-44480971 CTGGAGCCTCACAGCTGGAAGGG - Intergenic
1082117936 11:48347092-48347114 ATGCAGCTCCTCACCAGCAAGGG + Intergenic
1082123324 11:48403434-48403456 ATGCAGCTCCGCACCAGCAATGG + Intergenic
1082144333 11:48648877-48648899 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1082147172 11:48684112-48684134 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1082150700 11:48735083-48735105 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1082317708 11:50750144-50750166 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1082568832 11:54713593-54713615 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1082599684 11:55133809-55133831 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1082905969 11:58309169-58309191 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1083400385 11:62419237-62419259 CAGCAGCTCCAGAGCAGGAATGG - Intronic
1083509061 11:63190576-63190598 ATGCAGCTCCTCACCAGCAATGG - Intronic
1084247592 11:67870699-67870721 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1084359774 11:68661773-68661795 ATTGGTCTCCACAGCTGGAACGG - Intergenic
1084825232 11:71724796-71724818 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1085222716 11:74888529-74888551 ATGCAGCTCCTCACCAGCAACGG + Intronic
1085248086 11:75120377-75120399 ATGCAGCTCCTCACCAGCAACGG + Intronic
1085399396 11:76226554-76226576 ATTCAGGTCCACAGCTAGACTGG - Intergenic
1085495507 11:76964921-76964943 ATGCAGCTCCTCACCAGCAATGG + Intronic
1086301087 11:85426738-85426760 ATACAGCTCCACACCAGCAATGG + Intronic
1086565635 11:88223225-88223247 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1088370419 11:109083097-109083119 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1088974843 11:114806306-114806328 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1089097428 11:115930962-115930984 ATTGAGCTCCACAGCTGCAAAGG - Intergenic
1089106060 11:116006012-116006034 ATGCAGCTCCTCACCCGCAATGG + Intergenic
1089329640 11:117680519-117680541 GTGCAGCTCCAGGGCTGGGAGGG + Intronic
1089816101 11:121177205-121177227 ATGCAGCTCCTCACCAGCAACGG - Intronic
1089897117 11:121941804-121941826 ATTAAGCTCCACCTCTGGAAAGG - Intergenic
1090737415 11:129622258-129622280 TCACAGCTCCACAGCTGCAAGGG - Intergenic
1090747002 11:129713638-129713660 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1091052406 11:132384516-132384538 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1092323921 12:7509304-7509326 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1092417872 12:8306093-8306115 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1093111710 12:15160723-15160745 ACGCAGCCCCACAGCTTGGATGG + Intronic
1093217596 12:16382168-16382190 ATGCAGCTCCTCACCAGCAACGG - Intronic
1093501372 12:19815601-19815623 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1093609483 12:21136861-21136883 ATGCAGCTCCTCACCAGCAACGG - Intronic
1094381674 12:29849553-29849575 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1094387537 12:29910997-29911019 ATGCAGCTCCTCACCAGCAAAGG + Intergenic
1094792335 12:33929357-33929379 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1094792588 12:33931533-33931555 ACGCAGCTCCTCACCAGGAATGG + Intergenic
1094805299 12:34084335-34084357 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1094810658 12:34134431-34134453 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1094873442 12:34613535-34613557 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1095073929 12:37893493-37893515 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1095088652 12:38084737-38084759 GTCCAGCTGCACACCTGGAATGG - Intergenic
1095103870 12:38208316-38208338 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1095105585 12:38229875-38229897 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1095167319 12:38988776-38988798 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1095231693 12:39747037-39747059 ATGCAGCTCCTCACCAGCAATGG + Intronic
1095429018 12:42112256-42112278 ATGCAGCTCCTCACCAGCAATGG + Intronic
1095483314 12:42658398-42658420 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1095971226 12:47903287-47903309 AGTCAGCCCCACAGCTGGATTGG + Intronic
1096359754 12:50973600-50973622 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1096959298 12:55561540-55561562 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1097124404 12:56762452-56762474 ATGCAAATCCCCTGCTGGAATGG - Intronic
1097304376 12:58052910-58052932 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1097344498 12:58476435-58476457 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1097408978 12:59227351-59227373 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1097561218 12:61208622-61208644 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1097569755 12:61317829-61317851 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1097740916 12:63241483-63241505 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1097758666 12:63435251-63435273 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1098642521 12:72856461-72856483 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1098844793 12:75522465-75522487 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1098923116 12:76320599-76320621 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1099123088 12:78717354-78717376 TTACAGCTCCACGGCTTGAATGG - Intergenic
1099285015 12:80706894-80706916 ATACTGCTCCACAAATGGAAGGG + Intergenic
1099512357 12:83554146-83554168 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1099764991 12:86971489-86971511 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1100517982 12:95346746-95346768 ATGTAGCCCAACAGCTAGAATGG + Intergenic
1101175141 12:102142523-102142545 ATGCAGCTCCTCACCAGCAATGG - Intronic
1101313991 12:103612716-103612738 ATGCAGCTCCTCACCAGCAATGG - Intronic
1102099924 12:110270374-110270396 ATGCATCTTCCCAGATGGAACGG + Intergenic
1103444146 12:120983061-120983083 ATTCATCTCCACATCTGGAGGGG - Intronic
1105311761 13:19218596-19218618 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1105622881 13:22086313-22086335 ATTCAGCTCCACAGCAGAAGAGG + Intergenic
1105851984 13:24342961-24342983 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1105875896 13:24553440-24553462 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1107558463 13:41539775-41539797 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1109113361 13:58351587-58351609 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1110729131 13:78859937-78859959 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1111078902 13:83276749-83276771 ATCATGTTCCACAGCTGGAAAGG - Intergenic
1111375047 13:87367767-87367789 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1112745573 13:102523124-102523146 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1112835303 13:103507532-103507554 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1113612285 13:111655681-111655703 GAGCAGCTCCACTGCAGGAAGGG + Intronic
1115018020 14:28640688-28640710 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1115792642 14:36897566-36897588 ATGCAGCTCCTCACCAGCAACGG - Intronic
1116026937 14:39526588-39526610 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1116042482 14:39702615-39702637 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1116198223 14:41756787-41756809 ATGCAGCTCCTCACCAGCAATGG - Intronic
1116306473 14:43263037-43263059 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1116704931 14:48284736-48284758 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1116773002 14:49149018-49149040 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1117184630 14:53227459-53227481 ATGGAGCCCCACTGCTGGAGAGG + Intergenic
1117576615 14:57105520-57105542 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1117675271 14:58149437-58149459 AAGCAGCCCCAGAGCTGGCAGGG + Intronic
1117936497 14:60913357-60913379 ATGCAGCTCCTCACCAGCAACGG - Intronic
1118094617 14:62522187-62522209 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1118717764 14:68572468-68572490 AAGCAGCCCCCCAGCTGCAAGGG - Intronic
1118938400 14:70310081-70310103 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1119156250 14:72414592-72414614 ATGCAGCTCCTCACCAGCAACGG - Intronic
1119467861 14:74873498-74873520 ATAGAACTCCAGAGCTGGAAAGG + Intergenic
1120670708 14:87359754-87359776 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1122034551 14:98937886-98937908 ATGCAGCTCCAGAGCCCAAAAGG + Intergenic
1122066746 14:99179058-99179080 AGGCGGCTCTACAGCTGAAATGG + Intronic
1122407494 14:101509047-101509069 AGGGAGCTCTACAGCTGGGAAGG - Intergenic
1122667747 14:103345226-103345248 ATGCAAGTCCACAGCTGGACAGG - Intergenic
1123397281 15:19949314-19949336 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1123797672 15:23789102-23789124 ACGCAGGTTCACAGCTGGAGAGG + Intergenic
1123822468 15:24044287-24044309 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1125058472 15:35390872-35390894 ATGCAGCTCCTCACCAGCAATGG - Intronic
1125482950 15:40093075-40093097 AGCCAGCGGCACAGCTGGAAAGG + Intronic
1125535161 15:40438228-40438250 AAGCCCTTCCACAGCTGGAAAGG - Intergenic
1126905525 15:53360486-53360508 ATGCAGCTCCACACATGGGGAGG + Intergenic
1128576604 15:68780266-68780288 AGACATCTGCACAGCTGGAAGGG + Intronic
1128941137 15:71788641-71788663 ATGGAGATACACAGCTGCAATGG - Intergenic
1129010557 15:72412615-72412637 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1129631089 15:77261233-77261255 ATGCAGCTCCTCACCAGCAATGG + Intronic
1129851708 15:78797436-78797458 AGGCAGCTCCTCACCTGGACTGG + Intronic
1132304707 15:100802679-100802701 TTCCAGCTCCACTGCTGGCATGG - Intergenic
1133216189 16:4293908-4293930 CCGCAGCTGCACAGCAGGAAAGG - Intergenic
1133851799 16:9511648-9511670 ATTCAGCTGGACAGCTGGGAGGG + Intergenic
1133938842 16:10291736-10291758 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1134255246 16:12604876-12604898 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1134509249 16:14833512-14833534 ATTCACCATCACAGCTGGAAAGG - Intronic
1134696952 16:16232326-16232348 ATTCACCATCACAGCTGGAAAGG - Intergenic
1134879678 16:17734249-17734271 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1134898068 16:17907508-17907530 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1134974886 16:18562358-18562380 ATTCACCATCACAGCTGGAAAGG + Intergenic
1135423062 16:22317322-22317344 ATGCAGCTGCAAAGCTGGGCAGG - Intronic
1136652941 16:31688298-31688320 ATGCAGCTCCCCACCAGCAATGG + Intergenic
1137224619 16:46490953-46490975 ATGCAGCTCCTCATCAGCAATGG + Intergenic
1137326129 16:47438796-47438818 ATGCAGCTCCTCATCAGCAATGG + Intronic
1137347937 16:47682793-47682815 ATGCAGCTCCTCACCAGCAACGG - Intronic
1137371570 16:47910965-47910987 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1137877621 16:52012644-52012666 ATGCAGCTCCTCACCAGCAATGG - Intronic
1138007219 16:53349438-53349460 ATGCAGCTCCTCACCAGAAATGG - Intergenic
1138345690 16:56318671-56318693 AAGCAGCTCCTCAAATGGAAGGG + Intronic
1138734151 16:59230746-59230768 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1138874875 16:60937035-60937057 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1138903441 16:61302152-61302174 ATGCATATGCACAGCTGGACAGG - Intergenic
1139000760 16:62506899-62506921 ATACAGATTCACAGCTGGAAAGG + Intergenic
1140732423 16:77868828-77868850 ATGCTGCTCAACATCTGCAATGG - Intronic
1140984066 16:80141343-80141365 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1143422641 17:6807498-6807520 ATGCAGCTCCTCACCAGCAATGG - Intronic
1143487713 17:7263570-7263592 AGGAAGCTCCAAAGCAGGAAAGG - Intronic
1143957630 17:10685248-10685270 AGACAGCTTCACAGCTAGAAAGG + Intronic
1144456818 17:15425673-15425695 ATTAAGCTCCACCTCTGGAAGGG + Intergenic
1144734995 17:17550372-17550394 TTGCAGATGCACAGCTGGGACGG + Intronic
1146298425 17:31669956-31669978 ATGCAGCTCCTCAGCAGCAATGG - Intergenic
1146580324 17:34031473-34031495 ATGCAGCTCCTCACCAGCAATGG + Intronic
1149227766 17:54495296-54495318 GTGCAGGTCCACAACTGGAAAGG + Intergenic
1149253282 17:54794746-54794768 CTGCAGCTGCACAGATAGAAAGG - Intergenic
1150389818 17:64783800-64783822 ATCCAGCTCCAAAGCTGGGTGGG + Intergenic
1152407973 17:80108281-80108303 CTGCAGGACCACATCTGGAAGGG - Intergenic
1153090446 18:1336305-1336327 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1153419945 18:4893680-4893702 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1153572841 18:6490751-6490773 AAGCAGCCCCAAAGCTGGATTGG + Intergenic
1153593617 18:6700899-6700921 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1154352600 18:13598794-13598816 TTGATGCTCCACAGCTGGAGTGG + Intronic
1154401474 18:14042624-14042646 ATGCAGCTCCTCACCAGCAAAGG - Intergenic
1156206930 18:34895877-34895899 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1156296052 18:35791707-35791729 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1156980916 18:43287026-43287048 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1157839153 18:50938726-50938748 TGACAGCTCCATAGCTGGAATGG + Intronic
1157920026 18:51705642-51705664 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1159126540 18:64231358-64231380 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1161474193 19:4475125-4475147 ATGCAGCTTCCCATCGGGAAGGG + Intronic
1164265705 19:23614506-23614528 ATGCAGCTCCTCACCAGCAATGG + Intronic
1164542846 19:29133686-29133708 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1165886920 19:39084884-39084906 ATTCAGCTGCACAGCTAGGATGG - Intronic
1166022261 19:40042932-40042954 ATGCAGCTCCTCACCAGCAATGG - Intronic
1166171954 19:41034160-41034182 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1166387874 19:42392072-42392094 AGACAGATTCACAGCTGGAAAGG - Intergenic
1166613863 19:44225794-44225816 ATGCAGCTCCTCACCAGCAATGG - Intronic
1167645863 19:50704423-50704445 CTGCAGCCCCAGACCTGGAAGGG + Exonic
1168437871 19:56336614-56336636 ATGCAGCTCCTCACCAGCAACGG - Intronic
925260309 2:2522948-2522970 AGGCAGGTCCACAGCCGCAAAGG - Intergenic
925631108 2:5894484-5894506 ATGCAGCAGCACTGCTGCAATGG - Intergenic
925859900 2:8163982-8164004 ATGCATCTCCCCAGCCTGAATGG + Intergenic
926056366 2:9776307-9776329 GTGCTGCTCCCCAGCTGGGAAGG - Intergenic
926917618 2:17908490-17908512 ATGCAGCTCCACGCCAGCAACGG - Intronic
927016792 2:18971868-18971890 ATGAAGCTATACAGCTGGCAAGG - Intergenic
927235913 2:20874874-20874896 ATGCAGCTCCTCACCAGCAATGG - Intergenic
927345013 2:22027909-22027931 ACACAGCTCCAAAGCTGGACTGG - Intergenic
927447105 2:23172634-23172656 ATGCAGCTCCTCACCAGCAATGG + Intergenic
928759043 2:34560342-34560364 ATGCAGCTCCTCACCAGCAATGG - Intergenic
928852634 2:35767546-35767568 ATGCAGCTCCTCACCAGCAATGG + Intergenic
929068924 2:38009740-38009762 ATGCAGCTCCTCACCAGCAACGG - Intronic
929638224 2:43547895-43547917 ATGCAGCTCCTCACCAGCAACGG - Intronic
930830781 2:55741394-55741416 ATGCAGCTCCTCACCAGCAACGG - Intergenic
930987681 2:57609802-57609824 ATGCAGCTCCTCACCAGCAATGG + Intergenic
931469120 2:62520560-62520582 ATGCAGCTCCTCACCAGCAATGG - Intergenic
931477734 2:62606333-62606355 ATGCAGCTCCTCACCAGCAATGG + Intergenic
932019179 2:68064852-68064874 ATGCAGCTCCTCACCAGCAATGG + Intronic
932478015 2:72020976-72020998 ATGCAGCTCCTCACCAGCAAGGG - Intergenic
932642356 2:73461567-73461589 ACGCAGCTCCTCAGCAGCAACGG + Intronic
933023189 2:77220317-77220339 ATGCAGCTCCTCACCAGCAACGG + Intronic
933257490 2:80098036-80098058 ATGCAGCTCCTCACCAGCAATGG - Intronic
933568316 2:83977496-83977518 ATGCAGCTCCTCACCAGCAATGG + Intergenic
933579154 2:84105110-84105132 ATGCAGCTCCTCACCAGCAATGG + Intergenic
933593988 2:84263466-84263488 ATGCAGCTCCTCACCAGCAATGG + Intergenic
935118165 2:100156691-100156713 ATGCAGCTCCTCACCAGCAATGG - Intergenic
935347415 2:102121367-102121389 ACGTGGCTCCACAGCTGCAAGGG - Intronic
935843918 2:107144312-107144334 ATGCAGCTCCTCACCAGCAATGG - Intergenic
937507346 2:122551797-122551819 ATGCAGCTCCTCACCAGCAATGG + Intergenic
938156749 2:128948326-128948348 ATGCAGCTCCTCACCAGCAACGG - Intergenic
938273979 2:129999599-129999621 ATGCAGCTCCTCACCAGCAACGG + Intergenic
940067132 2:149642907-149642929 ATGCAGCTCCTCACCAGCAATGG - Intergenic
940095270 2:149966828-149966850 ATGCAGCTCCTCACCAGCAACGG + Intergenic
940465747 2:154024723-154024745 ATGCAGCTCCTCACCAGCAACGG - Intronic
940516640 2:154691764-154691786 ATGCTGCTTCAGATCTGGAAAGG - Intergenic
940722993 2:157301959-157301981 ATGCAGCTTCACTCCTAGAAGGG - Intronic
941082764 2:161080888-161080910 ATGCAGCTGCACAGCTAGCGAGG - Intergenic
941344780 2:164354558-164354580 ATGAGGCTGTACAGCTGGAATGG + Intergenic
941559564 2:167027536-167027558 ATGCAGCTCCTCACCAGCAATGG - Intronic
941623863 2:167809314-167809336 ATGCAGCTCCTCACCAGCAATGG - Intergenic
942042217 2:172078509-172078531 AGGCAGGTCCACACCTGGACGGG + Intronic
942153811 2:173106568-173106590 ATTCAGCTCAACAGTTGCAAGGG + Intronic
942411850 2:175717680-175717702 ATGCAGCTCCTCACCAGCAATGG + Intergenic
943303512 2:186231427-186231449 ATGCAGCTCCTCACCAGTAATGG + Intergenic
944600814 2:201301034-201301056 ATGCAGCTCCTCACCAGCAATGG + Intronic
945351471 2:208785374-208785396 ATGCAGCTCCTCACCAGCAATGG + Intronic
945352793 2:208801746-208801768 ATGCAGCTCCTCACCAGCAACGG + Intronic
945416900 2:209585102-209585124 ATGCAGATCCAAAGCTGAGAAGG + Intronic
945495840 2:210506052-210506074 ATGCAGCTGGAGATCTGGAATGG + Intronic
945667260 2:212757744-212757766 ATGCAGCTCCTCAGCAGCAATGG + Intergenic
945889977 2:215420105-215420127 ATGCTGTTACACAGCTGGTAAGG + Intronic
945998052 2:216455811-216455833 ATGCAGCTCCTCACCAGCAATGG + Intronic
946454990 2:219818537-219818559 ATGCAGCTCCTCACCAGCAATGG - Intergenic
948918799 2:241051934-241051956 AAGCAGACCCACAGCTGGCAGGG - Intronic
949049015 2:241887287-241887309 CGGCAGCGCCACAGGTGGAAGGG - Intergenic
1170707679 20:18760265-18760287 ATGCAGCTCCTCACCAGCAATGG - Intronic
1171191400 20:23162064-23162086 AGGCAGCTCCACAGCAGAAAAGG + Intergenic
1171411931 20:24953318-24953340 CTGGAGCTCGATAGCTGGAAGGG + Intronic
1171898627 20:30835364-30835386 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1173232093 20:41206256-41206278 ACGCAGCTCCTCACCTGCAATGG + Intronic
1176421014 21:6515302-6515324 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1176638014 21:9267019-9267041 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1176743787 21:10632186-10632208 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1176930241 21:14801193-14801215 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1178044511 21:28678006-28678028 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1178828511 21:36035348-36035370 AGCCAGCTCCCCAGGTGGAAAGG + Exonic
1179696505 21:43123621-43123643 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1180370954 22:12036390-12036412 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1180422053 22:12874516-12874538 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1181342054 22:22188938-22188960 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1181446934 22:22984218-22984240 TTGCAGTTTCATAGCTGGAAGGG + Intergenic
1181554996 22:23664082-23664104 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1181800346 22:25343885-25343907 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1181861819 22:25824629-25824651 AAGCAGCTCCAAAGGTGCAAAGG - Intronic
1182004224 22:26945748-26945770 TTGCACCTCCACAGCTGAACTGG + Intergenic
1182035470 22:27195145-27195167 ATCCAGCTACACCGCTGGGAAGG + Intergenic
1182993389 22:34789801-34789823 ATGCAGCTCCTCACCAGGAACGG + Intergenic
1182996552 22:34817887-34817909 ATGCAGCTTCTCAGCAGCAATGG + Intergenic
1185153584 22:49180098-49180120 AAGCAGATCCACCTCTGGAATGG + Intergenic
949159064 3:859002-859024 ATGCAGCTGGACACCTGGGAAGG + Intergenic
949209306 3:1478578-1478600 ATGCAGCTCCTCATCAGCAATGG + Intergenic
949425364 3:3909900-3909922 ATGCAGCTCCTCACCAGCAATGG + Intronic
949717439 3:6950085-6950107 ATGCAGCTCCTCACCAGCAAAGG - Intronic
950189193 3:10964893-10964915 CTGAGGCTCCACAGCTAGAAAGG + Intergenic
950453130 3:13076661-13076683 TTGCAGTTCCACAGTTGGAACGG - Intergenic
950597104 3:13994733-13994755 ATGCAGCTCCTCACCAGCAACGG - Intronic
951028257 3:17852195-17852217 ATGAGGCTCCACCGCTTGAAAGG - Intronic
951672836 3:25204455-25204477 ATGCAGCTCCTCACCAGCAATGG - Intronic
951827312 3:26882454-26882476 ATGCAGCTCCTCACCAGCAACGG + Intergenic
951836729 3:26991519-26991541 ATGCAGCTCCTCACCAGCAATGG - Intergenic
951861884 3:27262862-27262884 ATGCAGCTCCTCACCAGCAATGG - Intronic
952049141 3:29362078-29362100 ATGCAGCTCCTCACCAGCAATGG - Intronic
952290653 3:32011552-32011574 ATGCAGCTCCTCACCAGCAATGG + Intronic
953053832 3:39371642-39371664 ATGCAGCTCCTCACCAGCAATGG - Intergenic
953219721 3:40958901-40958923 ATGCAGCTCCTCACCAGCAATGG - Intergenic
953305556 3:41825273-41825295 ATGCAGCTCCTCACCAGCAACGG + Intronic
953571532 3:44075595-44075617 AGGCTGCCCTACAGCTGGAAAGG + Intergenic
953666528 3:44929813-44929835 ATGCAGGTACACAGGTGGAGAGG + Intronic
954931477 3:54286040-54286062 ATGCAGCTCCTCACCAGCAACGG + Intronic
955269048 3:57478035-57478057 ATGCAGCTCCTCACCAGCAATGG + Intronic
955478043 3:59359833-59359855 ATGCAGCTCCTCACCAGCAATGG - Intergenic
955676389 3:61453353-61453375 ATGCAGTCCCAAAGATGGAATGG - Intergenic
955737661 3:62056915-62056937 AAGGAGGTCCACAGATGGAATGG + Intronic
956179659 3:66505236-66505258 CTGCAGTTCCACAGCAAGAATGG + Intergenic
956866376 3:73373490-73373512 ATGCAGCTCCTCACCAGCAATGG - Intergenic
957214216 3:77298351-77298373 ATGAAGTTTCATAGCTGGAAAGG + Intronic
957344682 3:78945630-78945652 ATGCAGCTCCTCACCAGCAACGG + Intronic
958167878 3:89900501-89900523 ATGCAGCTCCTCACCAGCAACGG + Intergenic
958722297 3:97859213-97859235 ATTCAGCTCCACTGATGAAAGGG + Intronic
958749234 3:98175198-98175220 ATGCAGCTCCTCACCAGCAATGG + Intronic
958826400 3:99035889-99035911 ATGCAGCTCCTCACCAGCAATGG + Intergenic
958835440 3:99140077-99140099 ATGCAGCTCCTCACCAGCAATGG - Intergenic
959940051 3:112071983-112072005 ATGCAGCTCCTCACCAGCAACGG - Intronic
959949636 3:112165302-112165324 ATGCAGCTCCTCACCAGCAATGG - Intronic
959981098 3:112518719-112518741 ATGCAGCTCAACAGCACCAATGG + Intergenic
960711139 3:120529772-120529794 ATGCAGTTAAACTGCTGGAAAGG - Intergenic
960859930 3:122142124-122142146 ATGCAGCTCCTCACCAGCAATGG - Intergenic
960986457 3:123284304-123284326 GTGCTGCTGCACAGGTGGAAAGG - Exonic
961291609 3:125850908-125850930 ATGCAGCTCCTCACCAGCAATGG + Intergenic
961895576 3:130165470-130165492 ATGCAGCTCCTCACCAGCAATGG - Intergenic
961958881 3:130832915-130832937 ATGCAGCTCCTCACCAGCAACGG + Intergenic
962233026 3:133682311-133682333 ATGCAGCTCCCCACCAGCAACGG + Intergenic
962350017 3:134649879-134649901 AAGGAGCTCCAGAGCTGGAGGGG + Intronic
962354629 3:134683339-134683361 ATACAACTTCAGAGCTGGAAGGG + Intronic
962657066 3:137557873-137557895 ATGCAGCTCCTCACCAGCAACGG + Intergenic
962761484 3:138518793-138518815 ATGCAGCTCCTCACCAGCAATGG + Intronic
963633723 3:147767188-147767210 AAGCAGCTGCCAAGCTGGAAAGG - Intergenic
963678852 3:148348365-148348387 ATGCAGCTCCTCACCAGCAACGG + Intergenic
963825265 3:149946028-149946050 ATGCAGCTCCTCACCAGCAACGG + Intronic
963978588 3:151510575-151510597 ATGCAGCTCCTCACCAGCAATGG + Intergenic
965717829 3:171625963-171625985 ATGCAGCTCCTCACCAGCAACGG + Intronic
965886299 3:173451092-173451114 ATGCAGCTCCTCACCAGCAATGG - Intronic
966232153 3:177664387-177664409 ATGCAGCTCCTCACCAGCAATGG - Intergenic
966460356 3:180169129-180169151 ATGGAGCCCTACTGCTGGAAAGG + Intergenic
966757851 3:183388303-183388325 ATGCAGCTCAAGGTCTGGAATGG - Intronic
967797079 3:193610066-193610088 ATGCAGCTCCTCACCAGCAACGG - Intronic
968097921 3:195945226-195945248 ATGCAGCTGCAGACCTGGAGAGG - Intergenic
968305134 3:197645532-197645554 ATGCAGCTGCAGACCTGGAGAGG - Intergenic
1202748881 3_GL000221v1_random:138002-138024 ATGCAGCTCCTCACCAGCAATGG - Intergenic
968375940 4:41602-41624 ATGCAGCTCCTCACCAGCAATGG - Intergenic
969188184 4:5495606-5495628 ATGCAGCTCCTCACCAGCAACGG - Intronic
969671763 4:8593574-8593596 ATGCACCCCCACACCTGGAGAGG - Intronic
969747196 4:9081647-9081669 ATGCAGCTCCTCACCAGCAATGG + Intergenic
970358284 4:15279629-15279651 ATGCAGCTCCTCACCAGCAATGG + Intergenic
970364174 4:15341796-15341818 AGGCAGCTCTAGAGCTGGGATGG + Intronic
970516675 4:16838406-16838428 CTGTGGCTCCACATCTGGAAAGG + Intronic
970611610 4:17729876-17729898 ATGCAGCTCCTCACCAGCAATGG + Intronic
970611694 4:17730698-17730720 ATGCAGCTCCTCACCAGCAATGG + Intronic
970983084 4:22124106-22124128 ATGCAGCTCCTCAGCAGCAATGG + Intergenic
971230287 4:24795851-24795873 TTGCAGATCCACAGGAGGAACGG - Intronic
971438568 4:26654904-26654926 ATGCAGCTCCTCACCAGCAATGG - Intronic
971441809 4:26695004-26695026 ATGCAGCTCCTCACCAGCAACGG + Intronic
971882565 4:32396852-32396874 AGAGAGCTCCACAGCTTGAATGG - Intergenic
972317779 4:37943865-37943887 ATGCAGCTCCTCACCAGCAATGG - Intronic
972898680 4:43655444-43655466 ATGCAGCTCCTCACCAGCAATGG + Intergenic
973055457 4:45652281-45652303 ATGCAGCTCCTCACCAGCAATGG + Intergenic
973546653 4:51989437-51989459 ATGCAGCTCCTCACCAGCAATGG - Intergenic
973667642 4:53178610-53178632 ATGCAGCTCCTCACCAGCAATGG + Intronic
973679266 4:53299056-53299078 ATGCAGCTCCTCACCAGCAATGG + Intronic
973693628 4:53467452-53467474 ATGCAGCTCCTCACCAGCAATGG + Intronic
973923078 4:55708749-55708771 ATGCAGCTCCTCACCAGCAATGG + Intergenic
974426119 4:61744826-61744848 ATGCAGCTCCTCACCAGCAACGG + Intronic
974536600 4:63182841-63182863 ATGCAGCTCCTCACCAGAAATGG + Intergenic
974774489 4:66462380-66462402 ATGCAGCTCCTCACCAGCAATGG - Intergenic
974841026 4:67300010-67300032 ATGCAGCTCCTCACCAGCAATGG - Intergenic
974947324 4:68543544-68543566 ATGCAGCTCCTCACCAGCAATGG + Intronic
974959714 4:68682559-68682581 ATGCAGCTCCTCACCAGAAATGG - Intergenic
975092717 4:70422939-70422961 ATGCAGCTCCTCACCAGCAATGG - Intergenic
975283912 4:72594816-72594838 ATGCAGCTCCTCACCAGCAACGG + Intergenic
975513517 4:75220040-75220062 ATGCAGCTCCTCACCAGCAACGG - Intergenic
975806415 4:78117860-78117882 ATGCAGCTCCTCACCAGCAATGG - Intronic
975887305 4:78981474-78981496 ATGCAGCTCCTCATCAGCAACGG - Intergenic
976918608 4:90408743-90408765 ATGCAGCTCCTCACCAGCAACGG + Intronic
977110203 4:92943609-92943631 ATGCAGCTCCTCACCAGCAATGG - Intronic
977157648 4:93594085-93594107 ATGCAGCTCCTCACCAGCAACGG - Intronic
977478083 4:97538155-97538177 ATGCAGCTCCTCACCAGCAATGG + Intronic
977617058 4:99098890-99098912 ATGCAGCTCCTCATCAGCAATGG - Intergenic
978197032 4:105984095-105984117 ATGCAGCTCCTCACCAGCAATGG - Intronic
978548476 4:109899333-109899355 ATGCAGCTCCTCACCAGCAATGG - Intergenic
979236386 4:118404783-118404805 ATGCAGCTCCTCACCAGCAATGG + Intergenic
979440266 4:120742390-120742412 ATGCAGCTCCTCACCAGCAATGG + Intronic
979599672 4:122574215-122574237 ATGCAGCTCCTCACCAGCAACGG - Intergenic
979886217 4:126030841-126030863 ATGCAGCTCCTCACCAGCAACGG + Intergenic
980090305 4:128436533-128436555 ATGCAGCTCCTCACCAGCAATGG - Intergenic
981109215 4:140916156-140916178 ATGCAGCTCCTCACCAGCAATGG + Intronic
981247595 4:142558016-142558038 ATGCAGGTCAAGAGCTGCAAAGG - Intronic
981441903 4:144792688-144792710 ATGCAGCTCCTCACCAGCAACGG + Intergenic
981607695 4:146557951-146557973 ATGCAGCTCCTCACCAGCAATGG - Intergenic
982310755 4:153983106-153983128 ATGCAGCTCCTCACCAGCAATGG - Intergenic
982405954 4:155020805-155020827 ATGCAGCTCCTCACCAGCAACGG - Intergenic
982801662 4:159714568-159714590 ATGCAGCTCCTCACCAGCAACGG - Intergenic
982820060 4:159934102-159934124 ATGCAGCTCCTCACCAGCAATGG - Intergenic
982838755 4:160156203-160156225 ATGCAGCTCCTCACCAGCAATGG - Intergenic
983502970 4:168520779-168520801 ATGCATTTATACAGCTGGAATGG - Intronic
983668403 4:170208182-170208204 ATGCAGCTCCTCACCAGCAATGG + Intergenic
983694321 4:170510125-170510147 ATGCAGCTCCTCACCAGCAATGG - Intergenic
983978649 4:173967923-173967945 ATGCAGCTCCTCACCAGCAATGG - Intergenic
984307699 4:178016008-178016030 ATGCAGCTCCTCACCAGCAACGG + Intergenic
985072849 4:186185424-186185446 ATGCAGCTCCTCACCAGCAATGG - Intergenic
985159285 4:187027438-187027460 AAGCAGCTCACCAGCTGGAAGGG - Intergenic
1202752911 4_GL000008v2_random:25436-25458 ATGCAGCTCCTCACCAGCAATGG + Intergenic
985741847 5:1622206-1622228 ATGCAGCTGCAGACCTGGATAGG - Intergenic
985874227 5:2583272-2583294 AGGCAGCACCACAGATGGAAAGG - Intergenic
985877981 5:2614714-2614736 ATGCAGCTCCACAAGTGGACAGG + Intergenic
986655148 5:10003495-10003517 ATGCAGCTCCTCACCAGCAATGG + Intergenic
987100122 5:14583473-14583495 AGGCAGGAGCACAGCTGGAAAGG + Intronic
988646467 5:33100931-33100953 ATGCAGCTCCTCACCAGCAATGG - Intergenic
989302299 5:39908387-39908409 ATGCAGCTCCTCACCAGCAATGG + Intergenic
989562119 5:42863912-42863934 ATGCAGCTCCTCACCAGCAATGG + Intronic
989679799 5:44014886-44014908 ATGCAGCTCCTCACCAGCAATGG + Intergenic
989816866 5:45748097-45748119 ATGCAGCTCCTCACCAGCAACGG - Intergenic
990127308 5:52534336-52534358 ATGCAGCTCCTCACCAGCAATGG + Intergenic
990391951 5:55332326-55332348 ATTCAGCTACTCAACTGGAAAGG - Intronic
990576472 5:57128194-57128216 ATACAGCTCCTCAACTGGAAAGG - Intergenic
990657290 5:57971640-57971662 ACGCAGCTCCTCAGCAGCAATGG - Intergenic
990678735 5:58217004-58217026 ATGCAGCTCCTCACCAGCAATGG + Intergenic
990714117 5:58617409-58617431 ATGCACCAACACAGCTGGAAAGG + Intronic
990750558 5:59011251-59011273 ATGCAGCTCCTCACCAGCAACGG + Intronic
991209564 5:64088284-64088306 ATGCAGCTCCTCACCAGCAATGG + Intergenic
991428922 5:66523252-66523274 ATTCAGCACCACAAATGGAAAGG + Intergenic
991487272 5:67150563-67150585 GTGCAGCTGCACAGATGGGAAGG + Intronic
991634728 5:68692677-68692699 ATGCAGCTCCTCACCAGCAATGG + Intergenic
992031819 5:72728702-72728724 ATGCAGCTCCTCACCAGCAATGG + Intergenic
992107804 5:73464531-73464553 ATCCAGCTCCCCAGCTGCACAGG - Intergenic
992274562 5:75101962-75101984 ATGCAGCTCCTCAACAGCAACGG - Intronic
992634175 5:78710847-78710869 ATGCAGCTCCTCACCAGCAACGG + Intronic
992659421 5:78944308-78944330 ATGCAGCTCCTCACCAGCAACGG - Intronic
992854400 5:80845940-80845962 TTGCAGCTCCTCAGCAGCAATGG - Intronic
993471497 5:88313034-88313056 ATGCAGCTCCTCACCAGCAACGG - Intergenic
993888390 5:93443151-93443173 ATGCAGCTCCTCACCAGCAATGG + Intergenic
993917662 5:93762162-93762184 ATGCAGCTCCTCACCAGCAATGG + Intronic
994287934 5:97992410-97992432 ATGCAGCTCCTCACCAGCAACGG + Intergenic
994574002 5:101553507-101553529 ATGCAGCTCCTCACCAGCAACGG - Intergenic
994664170 5:102688456-102688478 ATGCAGCTCCTCACCAGCAACGG - Intergenic
995270629 5:110216539-110216561 ATGCAGCTCCTCACCAGCAATGG - Intergenic
995329950 5:110935076-110935098 ATGCAGCTCCTCACCAGCAACGG + Intergenic
995633704 5:114162032-114162054 ATGCAGCTCCTCACCAGCAATGG - Intergenic
995665321 5:114535681-114535703 ATGCAGCTCCTCACCTGCAATGG - Intergenic
995763828 5:115594101-115594123 ATGAAGTTACAGAGCTGGAAAGG - Intronic
996012962 5:118501800-118501822 ATGCAGCTCCTCACCAGCAATGG - Intergenic
996085274 5:119299137-119299159 ATGCAGTTCCTCACCAGGAACGG - Intronic
996114252 5:119600423-119600445 ATGCAGCTCCTCACCAGCAATGG + Intronic
996832124 5:127752145-127752167 ATGCAGCTCCTCACCAGCAACGG - Intergenic
997107146 5:131033745-131033767 ATGCAGCTCCTCACCAGCAATGG - Intergenic
997112295 5:131088248-131088270 ATGCAGCTCCTCACCAGCAATGG + Intergenic
997117152 5:131137948-131137970 ATGCAGCTCCTCACCAGCAACGG - Intergenic
997184963 5:131872109-131872131 ATGCAGCTCCTCACCAGCAACGG + Intronic
998048442 5:139010493-139010515 ATGCAGCTCCTCACCAGCAACGG - Intronic
998626605 5:143853170-143853192 ATGCAGCTCCTCACCAGCAACGG + Intergenic
998645254 5:144054945-144054967 ATGCAGCTCTTCACCAGGAATGG - Intergenic
999570873 5:152918714-152918736 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1000553521 5:162695796-162695818 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1000831108 5:166102443-166102465 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1001180121 5:169512630-169512652 AGGCAGATCCACAGCTGGCCTGG - Intergenic
1001323475 5:170701853-170701875 TCGCAGCTCCACAGCTGAAGAGG - Intronic
1001781978 5:174376573-174376595 AGTCAGCTCCAGAGCTGGTAGGG - Intergenic
1001983453 5:176052848-176052870 ATGCAGCTCCTCACCAGCAATGG + Intronic
1002234015 5:177791204-177791226 ATGCAGCTCCTCACCAGCAATGG - Intronic
1002265467 5:178028829-178028851 ATGCAGCTCCTCACCAGTAACGG - Intronic
1002612655 5:180431635-180431657 CTGGAGCTCCACAGTTGGCAAGG - Intergenic
1004079097 6:12373247-12373269 ATTCAGCTCTACTGCTGTAAGGG - Intergenic
1004095565 6:12550289-12550311 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1004856078 6:19751619-19751641 CTCTAGCTCCACACCTGGAATGG - Intergenic
1005177130 6:23059461-23059483 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1005202587 6:23364003-23364025 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1005204059 6:23380579-23380601 CAGCAGATCCACAGCTGGTAAGG + Intergenic
1005847976 6:29797184-29797206 ATGAAGCTGCACTTCTGGAAAGG - Intergenic
1005863707 6:29922350-29922372 ATTCAGCTGCACCTCTGGAAGGG - Intergenic
1005884386 6:30085635-30085657 ATGCAGTTCCTCACCAGGAATGG - Intergenic
1005924560 6:30431378-30431400 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1007155381 6:39737498-39737520 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1007977970 6:46120543-46120565 ATGCAGCTCCTCAACAGCAATGG + Intergenic
1008163233 6:48103561-48103583 ACGCAGCTCCTCACCAGGAATGG + Intergenic
1008329502 6:50228337-50228359 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1008671665 6:53775125-53775147 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1009045348 6:58231630-58231652 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1009221164 6:60985960-60985982 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1009239069 6:61162586-61162608 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1009361283 6:62817823-62817845 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1009687105 6:66976019-66976041 ATGCAGCTCTACAGCAATAAAGG + Intergenic
1009782172 6:68284976-68284998 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1010031147 6:71271610-71271632 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1010281621 6:74029703-74029725 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1010553612 6:77252617-77252639 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1010737615 6:79460622-79460644 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1010990125 6:82470616-82470638 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1010993030 6:82501467-82501489 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1011081741 6:83496758-83496780 ATGCAGCTCCTCACCAGCAAGGG + Intergenic
1011295007 6:85817035-85817057 ACGCAGCTCCTCAGCAGCAATGG + Intergenic
1011308683 6:85957936-85957958 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1011519763 6:88192864-88192886 ATGCAGGGCCACAGCTAGCATGG - Intergenic
1012608710 6:101189231-101189253 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1012673744 6:102089169-102089191 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1012680267 6:102170639-102170661 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1012844816 6:104375704-104375726 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1013706733 6:112844255-112844277 ATGGAGAGCCACAGATGGAAAGG + Intergenic
1014345752 6:120267752-120267774 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1014848697 6:126313223-126313245 ATGCAGGTCCACAGATGGCAAGG + Intergenic
1016629427 6:146210891-146210913 ATGGAGATTCACAGCAGGAATGG + Intronic
1017961893 6:159230657-159230679 ATAAAGATCCACAACTGGAAGGG + Intronic
1018749427 6:166789973-166789995 ATGCAGCTCCTCACCAGCAATGG + Intronic
1018760071 6:166885919-166885941 ATGCAGCTCCTCACCAGCAATGG + Intronic
1018782979 6:167085969-167085991 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1020326260 7:6976917-6976939 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1020449207 7:8303145-8303167 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1020454204 7:8352707-8352729 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1021327578 7:19293434-19293456 ATGCAGCTCCACAGGAGCACTGG + Intergenic
1021699028 7:23299724-23299746 CTGCACATCCAGAGCTGGAAGGG + Intronic
1021900326 7:25279008-25279030 ATCAACCACCACAGCTGGAATGG - Intergenic
1022453693 7:30538576-30538598 ATGCAGCTCCTCACCAGCAATGG + Intronic
1023671823 7:42585602-42585624 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1024109838 7:46133947-46133969 ATGCAGCCCCACAGCTCACATGG - Intergenic
1024419308 7:49143470-49143492 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1024892454 7:54219222-54219244 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1025479261 7:60961575-60961597 ATGCAGTTCCACACCAGCAATGG + Intergenic
1025601065 7:62998237-62998259 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1025737262 7:64161620-64161642 ATGCAGCTCCTCACCAGCAACGG + Intronic
1025854077 7:65263308-65263330 GTCCAGCTGCACACCTGGAATGG - Intergenic
1025869324 7:65415884-65415906 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1025876186 7:65481374-65481396 ATGCAGCTCCTCACCAGCAAAGG + Intergenic
1026847134 7:73704588-73704610 ACACAGCGTCACAGCTGGAAGGG - Intronic
1027233799 7:76286386-76286408 ATGCAGCTCCCCAGCTTGGATGG - Exonic
1028159169 7:87466010-87466032 ATGCAGCTCCTCACCAGCAATGG + Intronic
1028308813 7:89302785-89302807 ATGCAGCTACAGTGCTTGAAGGG - Intronic
1028436267 7:90807577-90807599 ATGCAGCTCCTCACCAGCAACGG + Intronic
1028836521 7:95380313-95380335 ATGCAGCTCCTCACCAGCAATGG + Intronic
1029313265 7:99687134-99687156 ATGCAGCTCCTCACCAGCAATGG + Intronic
1030457876 7:109796079-109796101 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1030817621 7:114056029-114056051 ATGCAGCTCCTCACCAGCAATGG + Intronic
1031664472 7:124467762-124467784 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1032166969 7:129553048-129553070 ATGCTCTTACACAGCTGGAAGGG + Intergenic
1033066645 7:138161744-138161766 TGGCAGCTGCAGAGCTGGAAGGG - Intergenic
1035311273 7:157970552-157970574 ATGCAGCTGCGCAGATGGCAGGG + Intronic
1036212032 8:6850114-6850136 ATGCAGCTCCTCACCAGCAAAGG - Intergenic
1036672078 8:10797019-10797041 AAACAGCCCCACAGCTTGAATGG + Intronic
1036745612 8:11407088-11407110 ATGCAGCTCCTCACCAGCAACGG - Intronic
1038004450 8:23417875-23417897 TTGCAGCTCCACTGTTGGAGGGG - Intronic
1038206672 8:25473518-25473540 ATGCAGCCCCTCTCCTGGAAGGG - Intronic
1038394034 8:27233430-27233452 GAGGAGCTGCACAGCTGGAATGG + Intergenic
1038655829 8:29450300-29450322 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1038950042 8:32404210-32404232 GTGCAGTTCCACAGCTGCAGTGG + Intronic
1039146241 8:34450779-34450801 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1039154668 8:34541329-34541351 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1039351910 8:36772511-36772533 TTGGAGCTCCTCTGCTGGAAAGG - Intergenic
1039719081 8:40143227-40143249 GTGCAGCTCCTCAGCAGCAACGG - Intergenic
1040078574 8:43265603-43265625 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1040364736 8:46704293-46704315 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1040634223 8:49253705-49253727 ATTCAGCTCTACAGCTTCAAAGG - Intergenic
1040651047 8:49449006-49449028 ATGCAGCTCCTCAGCAGCAATGG + Intergenic
1041027275 8:53700187-53700209 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1041120927 8:54586027-54586049 ACGCAGCTCCTCACCTGCAACGG - Intergenic
1041161664 8:55050950-55050972 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1041214179 8:55583525-55583547 TTGCAGCAACATAGCTGGAAGGG + Intergenic
1041295762 8:56356232-56356254 ATGCAGCTCCTCACCAGCAAAGG - Intergenic
1041338170 8:56811607-56811629 ATGCAGCTCCTCACCGGCAAAGG - Intergenic
1041750298 8:61253950-61253972 ATGCAGCTCCTCACCAGCAACGG - Intronic
1041771685 8:61479613-61479635 ATGCAGCTCCTCACCAGCAACGG - Intronic
1041772088 8:61482308-61482330 ATGCAGCTCCTCACCAGCAATGG + Intronic
1042362157 8:67895040-67895062 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1042534474 8:69844395-69844417 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1043177714 8:77042953-77042975 ATGCAGCTCCTCACCAGTAATGG + Intergenic
1043613943 8:82102303-82102325 ATGGAGCTCCAAAACTGGAAAGG + Intergenic
1043730918 8:83679836-83679858 TTGCATCTCCACAGCGAGAAGGG + Intergenic
1044042401 8:87386224-87386246 ATGCAGCTCCTCACCAGCAACGG + Intronic
1044061944 8:87649114-87649136 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1044221326 8:89673234-89673256 ATGCAGCTCCGCACCAGCAATGG + Intergenic
1044225105 8:89709280-89709302 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1044272676 8:90265209-90265231 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1045083274 8:98651452-98651474 ATGCAGCTCCTCACCAGCAACGG + Intronic
1045547201 8:103140147-103140169 ATGAAGTACCACAGCTGGAAGGG + Intronic
1045939030 8:107716957-107716979 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1046683004 8:117192527-117192549 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1046704548 8:117435413-117435435 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1046836404 8:118806331-118806353 ATCAAGCTCTACAGCTGAAATGG - Intergenic
1047175417 8:122536183-122536205 ATGGATTTCCACAGGTGGAAAGG - Intergenic
1048156599 8:131961172-131961194 ATGCAGCTCCTCACCAGCAATGG + Intronic
1048316955 8:133369732-133369754 AGGCAGCCCAACAGCTGGAGTGG + Intergenic
1049105930 8:140612848-140612870 ATGCAGCTATGTAGCTGGAAGGG - Intronic
1049518447 8:143074873-143074895 ATTCAGCTCCACTGCGAGAAAGG + Intergenic
1049748215 8:144271923-144271945 TTGCACCTCCACAGCTGGGAGGG + Intronic
1050178892 9:2899079-2899101 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1050374049 9:4952737-4952759 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1050481265 9:6089526-6089548 ATGCACATACACAGATGGAATGG - Intergenic
1050509075 9:6375292-6375314 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1050509346 9:6377368-6377390 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1051314886 9:15818306-15818328 ATGCAGCTCCTCACCAGCAACGG + Intronic
1051578858 9:18649418-18649440 ATGCAGCTCCTCACCAGCAACGG - Intronic
1051905917 9:22094843-22094865 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1052197330 9:25733237-25733259 ATGCAGCTCCTCACCAGCAAGGG + Intergenic
1052239179 9:26250744-26250766 ATGCAGCTCCTCATCAGCAACGG + Intergenic
1052499526 9:29271302-29271324 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1052634349 9:31082183-31082205 CTGCAGTTCCACATCAGGAAAGG - Intergenic
1053029895 9:34766730-34766752 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1053038698 9:34850632-34850654 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1053309104 9:37004302-37004324 ATTCAGCTGTACAGCTGGAGAGG - Intronic
1053827185 9:42037157-42037179 ATGCAGCTCCTCATCAGCAATGG + Intronic
1054603377 9:67150275-67150297 ATGCAGCTCCTCATCAGCAATGG - Intergenic
1054851364 9:69849654-69849676 ATTCAGCTCCAGAGCTTCAAAGG - Intronic
1055207025 9:73744490-73744512 ACGCAGTTCCACAGCTGTACAGG + Intergenic
1055853848 9:80663209-80663231 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1055899517 9:81218255-81218277 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1056817527 9:89812375-89812397 ATTCTGCTCCACAACTGGACAGG + Intergenic
1058224066 9:102338316-102338338 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1058563884 9:106260388-106260410 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1059616931 9:115961855-115961877 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1060131035 9:121099511-121099533 ATGCAGCTCCTCACCAGCAATGG + Intronic
1060615741 9:125011144-125011166 ATGCAGCTCCTCACCAGCAACGG + Intronic
1061754251 9:132801925-132801947 AAGCAGCCCCAGAGCTGGATTGG - Intronic
1061950086 9:133931311-133931333 AAGCAGCTCCACAGCAGCGAGGG + Intronic
1062123169 9:134845185-134845207 ATCCTGCTACACAGCTGGAAGGG - Intergenic
1203365871 Un_KI270442v1:255115-255137 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1203717522 Un_KI270742v1:168092-168114 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1203533703 Un_KI270743v1:10141-10163 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1203573288 Un_KI270744v1:152548-152570 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1203651740 Un_KI270751v1:131683-131705 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1185776835 X:2809968-2809990 ATGCAGCTCCACCTCTGGATGGG + Intronic
1186682535 X:11891011-11891033 AGGCAGCTGCCCAGCTGGCAAGG - Intergenic
1187045527 X:15644927-15644949 TTGCACCTCAACAGCAGGAAGGG + Exonic
1187857395 X:23650727-23650749 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1188035968 X:25317960-25317982 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1189045516 X:37586827-37586849 ATGCAGCTCCTCACCAGCAACGG - Intronic
1189062574 X:37769706-37769728 ATGCAGCTCCTCACCAGCAATGG + Intronic
1189415462 X:40808988-40809010 CTGCAACTCCACAGATAGAATGG + Intergenic
1189560721 X:42188991-42189013 AGGCAGCTACAGAGCTGGAATGG + Intergenic
1189939358 X:46104957-46104979 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1190358101 X:49625084-49625106 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1190554952 X:51624228-51624250 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1190923654 X:54882093-54882115 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1191049567 X:56177132-56177154 ATGCAGCTCCTCACCAGAAATGG - Intergenic
1191063293 X:56320753-56320775 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1191066831 X:56357658-56357680 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1191114771 X:56841221-56841243 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1191144445 X:57151788-57151810 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1191194867 X:57709628-57709650 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1191196579 X:57730405-57730427 ATGCAGCTCCTCACCAGCAAGGG - Intergenic
1191232805 X:58109198-58109220 ATGCAACTCCTCAGCAGCAATGG + Intergenic
1191628125 X:63290961-63290983 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1191683452 X:63865365-63865387 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1191704830 X:64083889-64083911 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1191828175 X:65388672-65388694 ATGCAGCTCCTCACCAGCAATGG - Intronic
1191882320 X:65855679-65855701 TTGCAGCTCCACACCAGCAATGG - Intergenic
1191935458 X:66423031-66423053 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1191990273 X:67027278-67027300 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1192007759 X:67235191-67235213 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1192015545 X:67326343-67326365 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1192045099 X:67664150-67664172 ATGCAGCTCCTCACCAGCAATGG - Intronic
1192071348 X:67943632-67943654 ATGCAGCTCCTCACCGGCAATGG + Intergenic
1192136274 X:68603356-68603378 ATGCAGCTCCTCACCAGCAAAGG + Intergenic
1192152996 X:68723678-68723700 ATGCAGCACCACAGCTGGGGGGG - Exonic
1192154929 X:68737347-68737369 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1192166809 X:68831690-68831712 ATGCAGCTCCACAGCTGGAAAGG + Intronic
1192385315 X:70661979-70662001 ATGCAGCTCCTCATCAGCAACGG + Intronic
1192401433 X:70839601-70839623 ATGCAGCTCCTCACCAGCAATGG + Intronic
1192523048 X:71817748-71817770 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1192850881 X:74954355-74954377 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1192900383 X:75489702-75489724 ATGCAGCTCCTCACCAGCAATGG + Intronic
1192985559 X:76395476-76395498 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1193029637 X:76883302-76883324 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1193154258 X:78156914-78156936 ATGCAGCTCCACACCAACAATGG - Intergenic
1193182172 X:78471259-78471281 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1193323840 X:80156333-80156355 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1193363069 X:80598740-80598762 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1193620942 X:83751596-83751618 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1193785588 X:85756742-85756764 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1194370155 X:93061279-93061301 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1194516656 X:94863349-94863371 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1195417441 X:104635873-104635895 ATGCAGCTCCTCACCAGCAATGG - Intronic
1195817563 X:108904749-108904771 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1196901657 X:120390103-120390125 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1197284884 X:124583647-124583669 ATGCAGCTCCTCACCAGCAACGG + Intronic
1197369909 X:125613980-125614002 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1197432575 X:126384244-126384266 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1197543069 X:127789879-127789901 ATGCAACTCCTCATCAGGAATGG + Intergenic
1197574956 X:128200033-128200055 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1197667804 X:129241949-129241971 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1197678136 X:129352913-129352935 ATGCAGCTCCTCACCAGCAACGG + Intergenic
1197737020 X:129858676-129858698 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1197771928 X:130094727-130094749 ATACGGCTTCACAGCTGGTAGGG + Intronic
1197988150 X:132289505-132289527 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1198615777 X:138456938-138456960 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1199484143 X:148330491-148330513 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1199884692 X:152007866-152007888 ATGCAGCTCCCCACCAGCAATGG + Intergenic
1200297831 X:154940126-154940148 ATGCAGCTCCTCACCAGCAATGG + Intronic
1200318710 X:155162449-155162471 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1200778685 Y:7195006-7195028 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1200874510 Y:8139351-8139373 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1201171680 Y:11273030-11273052 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1201293159 Y:12441498-12441520 ATGCAGCTCCACCTCTGGACGGG - Intergenic
1201393692 Y:13524990-13525012 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1201619969 Y:15945988-15946010 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1201645190 Y:16222882-16222904 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1201657623 Y:16362440-16362462 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1201684396 Y:16684301-16684323 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1201731969 Y:17213847-17213869 ATGCAGCTCCTCACCAGCAAAGG + Intergenic
1201778690 Y:17695092-17695114 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1201822866 Y:18210900-18210922 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1201908935 Y:19113947-19113969 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1201923115 Y:19255538-19255560 ATGCAGCTCCTCACCAGGAATGG + Intergenic
1201956823 Y:19633889-19633911 ATGCAGCTCCTCATCAGCAATGG - Intergenic
1201971559 Y:19802680-19802702 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1202014402 Y:20385585-20385607 ATGCAGCTCCTCACCAGCAACGG - Intergenic
1202020697 Y:20462292-20462314 ATGCAGCTCCTCACCAGAAATGG - Intergenic
1202055170 Y:20822233-20822255 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1202058096 Y:20857088-20857110 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1202166488 Y:21995157-21995179 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1202224870 Y:22591216-22591238 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1202256020 Y:22920907-22920929 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1202318244 Y:23604444-23604466 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1202333514 Y:23780582-23780604 ATGCAGCTCCTCATCAGCAATGG - Intergenic
1202409011 Y:24554660-24554682 ATGCAGCTCCTCACCAGCAATGG + Intergenic
1202461772 Y:25115418-25115440 ATGCAGCTCCTCACCAGCAATGG - Intergenic
1202537255 Y:25889481-25889503 ATGCAGCTCCTCATCAGCAATGG + Intergenic
1202552523 Y:26065613-26065635 ATGCAGCTCCTCACCAGCAATGG + Intergenic