ID: 1192168727

View in Genome Browser
Species Human (GRCh38)
Location X:68841594-68841616
Sequence TCCTTACCTTTGGCATCCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 158}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192168713_1192168727 22 Left 1192168713 X:68841549-68841571 CCCTGCAGAGCTGGGAGTTTCAC 0: 1
1: 0
2: 2
3: 26
4: 189
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168722_1192168727 -9 Left 1192168722 X:68841580-68841602 CCCACCCTGTTCTCTCCTTACCT 0: 1
1: 0
2: 3
3: 69
4: 658
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168715_1192168727 0 Left 1192168715 X:68841571-68841593 CCCCCACCCCCCACCCTGTTCTC 0: 1
1: 3
2: 27
3: 199
4: 1667
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168714_1192168727 21 Left 1192168714 X:68841550-68841572 CCTGCAGAGCTGGGAGTTTCACC 0: 1
1: 0
2: 0
3: 21
4: 216
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168720_1192168727 -7 Left 1192168720 X:68841578-68841600 CCCCCACCCTGTTCTCTCCTTAC 0: 1
1: 0
2: 4
3: 60
4: 530
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168721_1192168727 -8 Left 1192168721 X:68841579-68841601 CCCCACCCTGTTCTCTCCTTACC 0: 1
1: 0
2: 4
3: 67
4: 601
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168723_1192168727 -10 Left 1192168723 X:68841581-68841603 CCACCCTGTTCTCTCCTTACCTT 0: 1
1: 0
2: 7
3: 56
4: 767
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168718_1192168727 -3 Left 1192168718 X:68841574-68841596 CCACCCCCCACCCTGTTCTCTCC 0: 1
1: 1
2: 17
3: 177
4: 1616
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168717_1192168727 -2 Left 1192168717 X:68841573-68841595 CCCACCCCCCACCCTGTTCTCTC 0: 1
1: 0
2: 45
3: 237
4: 1070
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168719_1192168727 -6 Left 1192168719 X:68841577-68841599 CCCCCCACCCTGTTCTCTCCTTA 0: 1
1: 0
2: 5
3: 47
4: 595
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1192168716_1192168727 -1 Left 1192168716 X:68841572-68841594 CCCCACCCCCCACCCTGTTCTCT 0: 1
1: 0
2: 22
3: 1410
4: 2361
Right 1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192168727 Original CRISPR TCCTTACCTTTGGCATCCTT TGG Exonic
903658312 1:24962300-24962322 TCTTTTCCTTTGTAATCCTTTGG + Intronic
903738074 1:25543179-25543201 TCCAAACTTTTGGCTTCCTTAGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906077426 1:43062417-43062439 TCCTCACCTTCGTCATCTTTTGG - Intergenic
906552507 1:46677261-46677283 TGCTATACTTTGGCATCCTTTGG + Exonic
910072681 1:83237923-83237945 TCCTTACCCCTGGCCTGCTTTGG - Intergenic
910160382 1:84266159-84266181 TCCAAACTTTTGGCTTCCTTGGG + Intergenic
912569471 1:110610853-110610875 TCCTCCCCTTTGGGAGCCTTTGG - Intronic
916274021 1:162974341-162974363 TCATACCTTTTGGCATCCTTTGG + Intergenic
916484685 1:165248314-165248336 TCCATCCCTTTGGCCTCTTTGGG - Intronic
918405833 1:184211261-184211283 TGTTTACCTTTTACATCCTTTGG + Intergenic
919256314 1:195129040-195129062 TGCTTCTCTTTTGCATCCTTAGG + Intergenic
921721996 1:218482863-218482885 TGCTTCCTTTTGGCATCTTTTGG + Intergenic
922691227 1:227693168-227693190 TCCTTACCTCTTGCATGCTCTGG + Intergenic
1063536314 10:6887122-6887144 TCCCTACTTTTGGCTTCCCTGGG - Intergenic
1068842642 10:61632341-61632363 TTCTTACCTTTGGCTGCCTCTGG + Intergenic
1069180342 10:65351154-65351176 TCCATACCATTTGCATCCATTGG + Intergenic
1069778349 10:70939738-70939760 TCCCTTTCTTTGGAATCCTTTGG - Intergenic
1070653209 10:78252930-78252952 TCCCTGCATTTGGCATCCGTTGG + Intergenic
1070977288 10:80615169-80615191 TGCTGACCTTTGCCATCCTCGGG + Intronic
1076042069 10:127258930-127258952 ACCTTTCCTTTGGCCTCCTCTGG + Intronic
1077992471 11:7424280-7424302 TCCAAACCTTTGGCATCATGGGG - Intronic
1078754021 11:14191627-14191649 TGCTTTCATTTGGGATCCTTTGG - Intronic
1079284146 11:19114235-19114257 TCATTGCCATTGTCATCCTTGGG - Intergenic
1079853609 11:25570941-25570963 CCCTTACCTTAAGCATCCTTCGG - Intergenic
1083664403 11:64266729-64266751 TCCCTGGCTTTGGCGTCCTTGGG + Intronic
1085666399 11:78418301-78418323 TCCTTAACTCTGGCGTCCCTCGG + Intronic
1089036404 11:115397955-115397977 GCCATACTTTTGGCATCCTATGG + Intronic
1091144705 11:133267867-133267889 TCCTTACCTTCTGCATGGTTGGG + Intronic
1095864418 12:46956013-46956035 TTCTTGCCTTTCGCATCATTCGG + Intergenic
1096490065 12:52008209-52008231 TCCTTGCCTTGGGCAGCTTTGGG + Intronic
1096744138 12:53714554-53714576 TCCTCACCTGTGGCATCCACGGG + Intronic
1098722167 12:73913988-73914010 TCTTTTCCTTTGACTTCCTTAGG - Intergenic
1100093963 12:91008404-91008426 TCCTTACCCTTGGATTCCATGGG + Intergenic
1100349815 12:93769634-93769656 TCCTTATCTTTGGCAACACTTGG + Intronic
1101279202 12:103234125-103234147 TCCTGAGCCTTGGCATCCCTGGG + Intergenic
1102471183 12:113160789-113160811 TGATTCCCTGTGGCATCCTTAGG - Intronic
1104752277 12:131247402-131247424 TCCATGCCTTTGACATCCTCTGG - Intergenic
1105429024 13:20320257-20320279 TTCTTACCTTTGGGTTCCTTTGG - Intergenic
1106473804 13:30080342-30080364 TCTCTACCTTGGGCAGCCTTAGG - Intergenic
1109809747 13:67496674-67496696 TGCTTGCCTTTGGCAAACTTTGG + Intergenic
1114967254 14:27978279-27978301 TGCTTTCCACTGGCATCCTTTGG - Intergenic
1115029045 14:28773377-28773399 TCCTTTTCCTCGGCATCCTTCGG - Exonic
1120363191 14:83532204-83532226 TTCTTACCTCTGGGAACCTTAGG - Intergenic
1121448151 14:93991338-93991360 GCCTTACCTATGTCATCATTAGG + Intergenic
1121695091 14:95905716-95905738 TCATTACTTTTAGCATCCATCGG + Intergenic
1124225643 15:27891711-27891733 TCCATAGCTTTTGCATCCATGGG - Intronic
1125187484 15:36948222-36948244 TCCTAACCCTTGGCATTCTGTGG + Intronic
1131700479 15:94930114-94930136 ACATTACCTTTGGCATCATGGGG - Intergenic
1131825228 15:96316119-96316141 TCCTGTCCTTTTGCATCCATTGG + Intergenic
1132633561 16:931533-931555 TCCTTTCCTGTGGCCTCGTTCGG - Intronic
1138675054 16:58645166-58645188 TCCTTATCTTTGGCACCTTGTGG - Intergenic
1140112426 16:72015427-72015449 CCCTTCCCTTTGTCATCCCTGGG + Intronic
1140661851 16:77196110-77196132 TCCTTCCCTTTGGTCTCCTCTGG + Intronic
1142205916 16:88783137-88783159 TTCTTGCTTTTGGCCTCCTTGGG - Intronic
1142508293 17:379874-379896 TCCTTGCTTTTGGGATGCTTGGG - Intronic
1143698647 17:8640195-8640217 TCCTTGCCTTTGCCATGCTTTGG - Intergenic
1143922776 17:10343970-10343992 GCCTTGCCTTTGGCAGGCTTGGG + Exonic
1146804122 17:35851590-35851612 ACCTAACCTTTGTCATCCCTAGG - Intronic
1147083090 17:38041793-38041815 TGCTCATCTTTGGCATACTTTGG - Intronic
1147099033 17:38165766-38165788 TGCTCATCTTTGGCATACTTTGG - Intergenic
1150699081 17:67432137-67432159 TCCAAACTTTTGGCTTCCTTGGG + Intronic
1151824022 17:76513539-76513561 TCCTCACCTCTGTCAGCCTTTGG - Intergenic
1156225304 18:35100192-35100214 TTCTTACCTTTTACATCTTTGGG - Intronic
1158161464 18:54489356-54489378 TCATTGCCTTTGGCAACCTGAGG + Intergenic
1158640362 18:59198218-59198240 TCCCTACCTGTGGCCTCATTTGG - Intergenic
1159210805 18:65318884-65318906 TCCTTCCCTTTGGCAGCATGAGG - Intergenic
1160032086 18:75270910-75270932 TCTTTCCCTTCGGCCTCCTTTGG - Intronic
1160969619 19:1761751-1761773 ACCTGACCTTGGGCAGCCTTGGG + Intronic
1164871013 19:31642909-31642931 TCCTTCTCTTTGGCAGCTTTGGG - Intergenic
1166751968 19:45168521-45168543 TCCTTTCCTTGTGCATCCTTGGG - Intronic
925721616 2:6834197-6834219 TCCTTACCTCTTCCATCTTTTGG + Intergenic
926937845 2:18103980-18104002 TCCTTAAATCTGTCATCCTTGGG - Intronic
930779802 2:55213276-55213298 TCCTTGCCTTTTCCAGCCTTGGG + Intronic
932072692 2:68636732-68636754 TCCAGGCTTTTGGCATCCTTAGG + Intergenic
932720608 2:74136544-74136566 TCCAGTCCTTTGGCTTCCTTGGG - Intronic
933140384 2:78785129-78785151 TCCATAGGTTTGGCATCCATGGG + Intergenic
936679282 2:114752107-114752129 CCCTGACCATTGGCATCATTTGG - Intronic
938201277 2:129374883-129374905 TCCTCACCTATGGCTCCCTTTGG + Intergenic
940269776 2:151877406-151877428 TCCTAACCTTTGGATTCTTTTGG + Intronic
940840452 2:158573982-158574004 GCCTTTCCTTGGGCTTCCTTGGG + Intronic
941050709 2:160730474-160730496 TCTTTACCATTGGCATCCAAAGG + Intergenic
945931751 2:215862170-215862192 TCCTTATCTTTGCCAACATTTGG - Intergenic
1169811637 20:9614566-9614588 TTTTCACCTTTGGCATCTTTTGG - Intronic
1176046820 20:63097148-63097170 TCCTGACCTTGGGCTTCCCTGGG - Intergenic
1180785821 22:18547158-18547180 TCCCTACCTCTGGCACCCTCAGG + Intergenic
1181131104 22:20732883-20732905 TCCCTACCTCTGGCACCCTCGGG + Intronic
1181242746 22:21486712-21486734 TCCCTACCTCTGGCACCCTCAGG + Intergenic
1181771177 22:25126785-25126807 TTCTCAACTTTGACATCCTTTGG + Intronic
1183100105 22:35578679-35578701 GCCTTACCATGGGCATCCTGAGG + Intergenic
1184655661 22:45940808-45940830 TCCTCACCTCTCCCATCCTTTGG - Intronic
949479159 3:4477043-4477065 TCCATCCTCTTGGCATCCTTTGG + Intergenic
950533025 3:13563974-13563996 CCCTTCCCATTGGCATCGTTGGG - Intronic
952889786 3:38032105-38032127 TCCTGAACGTTGGCATTCTTGGG - Intergenic
953765662 3:45739337-45739359 TCCTTCCATTTAGCACCCTTTGG + Intronic
954471526 3:50700432-50700454 TCCCTACCTTTTCCAGCCTTTGG + Intronic
956327218 3:68067222-68067244 TCCTTACGTTAGGCATATTTAGG - Intronic
957443288 3:80281207-80281229 TCCACATCTTTGTCATCCTTTGG + Intergenic
958139558 3:89543984-89544006 TCCTTACCTTTGATATACCTTGG - Intergenic
958888967 3:99762304-99762326 TCCTAACATTTGTCATGCTTTGG + Intronic
960624283 3:119665323-119665345 TCTTTACCCTTCTCATCCTTAGG - Intronic
960926361 3:122798600-122798622 TTCTTGCTTCTGGCATCCTTGGG + Intronic
961169551 3:124787032-124787054 ATCTTATCTTTGGCATTCTTAGG + Intronic
963273825 3:143311000-143311022 TTCTTCCCTTTTGCAACCTTGGG - Intronic
963798821 3:149657604-149657626 ACCTTTCCTTTGCCATCCTGCGG - Intronic
969686553 4:8678108-8678130 TCATTACCTGTGTTATCCTTAGG - Intergenic
970021046 4:11568752-11568774 TCCTTACCTCCCACATCCTTTGG - Intergenic
970736195 4:19170968-19170990 CCCTTACCTTTGTAATCTTTAGG + Intergenic
972811746 4:42596240-42596262 TCCTTAACTTTGGCATTTTGGGG - Intronic
974543687 4:63272633-63272655 TCTCTACCTTTGGTTTCCTTAGG - Intergenic
974570225 4:63636356-63636378 TCTTTATCTTTGGGATCCTAGGG + Intergenic
985082063 4:186276375-186276397 TCCTTACCTTTGAGATTCTTTGG - Exonic
988332108 5:29855317-29855339 TCCTTGCCTTTTGCAGCCTCTGG - Intergenic
990417139 5:55597352-55597374 TCCCTGGCTTTGTCATCCTTTGG - Intergenic
992181150 5:74199732-74199754 TTCCTCCCTTTGGCATCCTCTGG - Intergenic
993642900 5:90427318-90427340 TTCTCACCGTTGGCATCCTTGGG + Intergenic
997611105 5:135216370-135216392 TCCTTTCCTTCAGGATCCTTAGG + Intronic
1003017840 6:2482334-2482356 TCCTGACCATTGGATTCCTTAGG - Intergenic
1003499022 6:6688856-6688878 TACTTGCCTTTGGCAGCCTCAGG - Intergenic
1007064702 6:38977910-38977932 TCCTTCCTTTTGGCCTCCTGGGG - Intronic
1010599424 6:77804963-77804985 TCTGTACTTTTGGCATCGTTTGG + Intronic
1010756811 6:79674746-79674768 TTCTTACCTGTAGCATCCTGAGG + Intronic
1010909127 6:81531485-81531507 TCCTTCACTTTGGCATCTTTGGG + Intronic
1012024443 6:93970802-93970824 TCCATACCTTATGCATCCATAGG + Intergenic
1012267536 6:97164173-97164195 TCCTTTCCTTGCCCATCCTTTGG - Intronic
1012741752 6:103025186-103025208 TCCTTATCTTTGCCAACATTTGG - Intergenic
1015036416 6:128660751-128660773 TCCTCACTTTTGTCATCTTTTGG - Intergenic
1015757406 6:136621644-136621666 TCCTTAGCTTTAGCCCCCTTAGG + Intronic
1021918822 7:25463032-25463054 TCCTTTTCTGTGGCTTCCTTAGG - Intergenic
1023228884 7:38003384-38003406 TCTTTACCTTTGTCTTCCTTTGG - Intronic
1023261271 7:38360762-38360784 TATTTACATTTGGCATCTTTTGG - Intergenic
1027290404 7:76703078-76703100 TCCTTACCCCTGGCCTGCTTTGG - Intergenic
1032372468 7:131371306-131371328 TCTTTATCTTTGGCATTCTTCGG + Intronic
1033094001 7:138413827-138413849 GCCTAACCTTTGGCTTCCCTAGG + Intergenic
1033119664 7:138656405-138656427 TACCTGCCTTTGGCATCCTATGG - Intronic
1033142544 7:138840460-138840482 TCCTTACCTATGGGACCCTCAGG - Intronic
1033593151 7:142831587-142831609 TCCTTACATTTGGAATCTTAGGG - Intergenic
1036046941 8:5153434-5153456 TCCCTGCCTTTGCCAGCCTTTGG - Intergenic
1036177304 8:6550911-6550933 TCCTTCCCCTTGGGCTCCTTGGG - Intronic
1036982158 8:13481952-13481974 TGCTAATCTTTGGCATTCTTTGG - Intronic
1037150983 8:15634907-15634929 TCCTTCACTTTGGCCTCCGTAGG + Intronic
1037534636 8:19813093-19813115 CCCATACCCTTGGCTTCCTTAGG - Intergenic
1039202707 8:35114170-35114192 TCCTTAACTTTATCATGCTTTGG + Intergenic
1042584079 8:70316088-70316110 TCCTTACCTTATGCATCGTGCGG - Intronic
1044340277 8:91039586-91039608 TCATTAACTTTTGCTTCCTTGGG + Intronic
1045481515 8:102596707-102596729 TCCCTACCCTTGGCCTCCCTTGG + Intergenic
1046008423 8:108514712-108514734 TTCTTACTTATGACATCCTTGGG - Intergenic
1048369963 8:133768671-133768693 TCCTTACCTCTGCCATCAATGGG - Intergenic
1049038392 8:140094463-140094485 ACCTTTCCTTTGGCAGCCTCTGG - Intronic
1049226547 8:141454073-141454095 GGCTTACCTTAGGTATCCTTAGG + Intergenic
1050083734 9:1942171-1942193 GCATTCCCTCTGGCATCCTTAGG + Intergenic
1051247707 9:15128366-15128388 TCCTTGCCTTTTCCATCTTTTGG - Intergenic
1051766674 9:20532546-20532568 TTCTTTCCTTTGGGAACCTTGGG - Intronic
1052566335 9:30157340-30157362 TTTTTACCTTTGACATCATTAGG + Intergenic
1053023155 9:34709493-34709515 TCCTCACCTCTTGCAGCCTTTGG + Exonic
1053469557 9:38336472-38336494 TCCCTCCCTTTGGCAGCCCTGGG - Intergenic
1061385255 9:130285768-130285790 GCCTGCTCTTTGGCATCCTTGGG + Intronic
1062304682 9:135898133-135898155 TCCTTCCCTTCTGCTTCCTTCGG - Intronic
1062494398 9:136825003-136825025 CCCTTCCCCTTGGAATCCTTGGG + Intronic
1189297176 X:39927059-39927081 TCCTTCCCTTTGTCAACTTTAGG - Intergenic
1190143021 X:47864748-47864770 TCCTTACCATAGGCATCTATGGG + Intronic
1190874915 X:54452900-54452922 TTCTCAACTTTGGCAACCTTTGG - Intronic
1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG + Exonic
1193183601 X:78486711-78486733 TCCTTAACTTTGCCATCTATAGG + Intergenic
1194310512 X:92300808-92300830 TTCTTTTCTTTGACATCCTTGGG + Intronic
1197210793 X:123826647-123826669 CGCTAACCCTTGGCATCCTTTGG - Intergenic
1198204058 X:134449692-134449714 TCATTACATTTAGAATCCTTTGG - Intergenic
1200618798 Y:5415094-5415116 TTCTTTTCTTTGACATCCTTGGG + Intronic