ID: 1192173610

View in Genome Browser
Species Human (GRCh38)
Location X:68872323-68872345
Sequence GAGACCAGCCGGCAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192173606_1192173610 -6 Left 1192173606 X:68872306-68872328 CCAGGCCAGGTGTCAGGGAGACC No data
Right 1192173610 X:68872323-68872345 GAGACCAGCCGGCAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192173610 Original CRISPR GAGACCAGCCGGCAGGCTGC AGG Intergenic
No off target data available for this crispr