ID: 1192174388

View in Genome Browser
Species Human (GRCh38)
Location X:68876790-68876812
Sequence GGGCCTTGTGGAGCTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192174388_1192174396 11 Left 1192174388 X:68876790-68876812 CCTGCTGTAGCTCCACAAGGCCC No data
Right 1192174396 X:68876824-68876846 TGCCTCCCTCTCCAGGCCTAAGG No data
1192174388_1192174395 4 Left 1192174388 X:68876790-68876812 CCTGCTGTAGCTCCACAAGGCCC No data
Right 1192174395 X:68876817-68876839 TCTGGCTTGCCTCCCTCTCCAGG No data
1192174388_1192174406 29 Left 1192174388 X:68876790-68876812 CCTGCTGTAGCTCCACAAGGCCC No data
Right 1192174406 X:68876842-68876864 TAAGGGAACTTCCTGGGACTGGG No data
1192174388_1192174403 23 Left 1192174388 X:68876790-68876812 CCTGCTGTAGCTCCACAAGGCCC No data
Right 1192174403 X:68876836-68876858 CAGGCCTAAGGGAACTTCCTGGG No data
1192174388_1192174402 22 Left 1192174388 X:68876790-68876812 CCTGCTGTAGCTCCACAAGGCCC No data
Right 1192174402 X:68876835-68876857 CCAGGCCTAAGGGAACTTCCTGG No data
1192174388_1192174405 28 Left 1192174388 X:68876790-68876812 CCTGCTGTAGCTCCACAAGGCCC No data
Right 1192174405 X:68876841-68876863 CTAAGGGAACTTCCTGGGACTGG No data
1192174388_1192174397 12 Left 1192174388 X:68876790-68876812 CCTGCTGTAGCTCCACAAGGCCC No data
Right 1192174397 X:68876825-68876847 GCCTCCCTCTCCAGGCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192174388 Original CRISPR GGGCCTTGTGGAGCTACAGC AGG (reversed) Intergenic
No off target data available for this crispr