ID: 1192175605

View in Genome Browser
Species Human (GRCh38)
Location X:68883172-68883194
Sequence CCTCAGCCCCTCCCAAAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192175605_1192175614 17 Left 1192175605 X:68883172-68883194 CCGACCTTTGGGAGGGGCTGAGG No data
Right 1192175614 X:68883212-68883234 TGGTTCAGATGTGTGCTGGCAGG No data
1192175605_1192175616 29 Left 1192175605 X:68883172-68883194 CCGACCTTTGGGAGGGGCTGAGG No data
Right 1192175616 X:68883224-68883246 GTGCTGGCAGGGAGCGTCCATGG No data
1192175605_1192175613 13 Left 1192175605 X:68883172-68883194 CCGACCTTTGGGAGGGGCTGAGG No data
Right 1192175613 X:68883208-68883230 CTGCTGGTTCAGATGTGTGCTGG No data
1192175605_1192175617 30 Left 1192175605 X:68883172-68883194 CCGACCTTTGGGAGGGGCTGAGG No data
Right 1192175617 X:68883225-68883247 TGCTGGCAGGGAGCGTCCATGGG No data
1192175605_1192175609 -3 Left 1192175605 X:68883172-68883194 CCGACCTTTGGGAGGGGCTGAGG No data
Right 1192175609 X:68883192-68883214 AGGGTGTCCTCCTTACCTGCTGG No data
1192175605_1192175615 18 Left 1192175605 X:68883172-68883194 CCGACCTTTGGGAGGGGCTGAGG No data
Right 1192175615 X:68883213-68883235 GGTTCAGATGTGTGCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192175605 Original CRISPR CCTCAGCCCCTCCCAAAGGT CGG (reversed) Intergenic
No off target data available for this crispr