ID: 1192177519

View in Genome Browser
Species Human (GRCh38)
Location X:68895195-68895217
Sequence CGCCTGAGCCTGCACCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192177519_1192177529 6 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177529 X:68895224-68895246 CAGGCAGGCAGTCGGCGGGCGGG No data
1192177519_1192177527 2 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177527 X:68895220-68895242 CAGGCAGGCAGGCAGTCGGCGGG No data
1192177519_1192177528 5 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177528 X:68895223-68895245 GCAGGCAGGCAGTCGGCGGGCGG No data
1192177519_1192177531 13 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177531 X:68895231-68895253 GCAGTCGGCGGGCGGGCGGACGG No data
1192177519_1192177530 9 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177530 X:68895227-68895249 GCAGGCAGTCGGCGGGCGGGCGG No data
1192177519_1192177532 14 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177532 X:68895232-68895254 CAGTCGGCGGGCGGGCGGACGGG No data
1192177519_1192177533 17 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177533 X:68895235-68895257 TCGGCGGGCGGGCGGACGGGCGG No data
1192177519_1192177525 -2 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177525 X:68895216-68895238 CGGGCAGGCAGGCAGGCAGTCGG No data
1192177519_1192177534 18 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177534 X:68895236-68895258 CGGCGGGCGGGCGGACGGGCGGG No data
1192177519_1192177526 1 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177526 X:68895219-68895241 GCAGGCAGGCAGGCAGTCGGCGG No data
1192177519_1192177535 24 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177535 X:68895242-68895264 GCGGGCGGACGGGCGGGCGCCGG No data
1192177519_1192177524 -9 Left 1192177519 X:68895195-68895217 CCAGGCGGGTGCAGGCTCAGGCG No data
Right 1192177524 X:68895209-68895231 GCTCAGGCGGGCAGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192177519 Original CRISPR CGCCTGAGCCTGCACCCGCC TGG (reversed) Intergenic
No off target data available for this crispr