ID: 1192179551

View in Genome Browser
Species Human (GRCh38)
Location X:68907940-68907962
Sequence AGCCAGCCGGGTCTCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192179551_1192179557 -2 Left 1192179551 X:68907940-68907962 CCTGCAGAGAGACCCGGCTGGCT No data
Right 1192179557 X:68907961-68907983 CTTAACAAAGAGGGAGTGGCTGG No data
1192179551_1192179558 5 Left 1192179551 X:68907940-68907962 CCTGCAGAGAGACCCGGCTGGCT No data
Right 1192179558 X:68907968-68907990 AAGAGGGAGTGGCTGGCTCAAGG No data
1192179551_1192179559 18 Left 1192179551 X:68907940-68907962 CCTGCAGAGAGACCCGGCTGGCT No data
Right 1192179559 X:68907981-68908003 TGGCTCAAGGTCTCATAAAGAGG No data
1192179551_1192179556 -6 Left 1192179551 X:68907940-68907962 CCTGCAGAGAGACCCGGCTGGCT No data
Right 1192179556 X:68907957-68907979 CTGGCTTAACAAAGAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192179551 Original CRISPR AGCCAGCCGGGTCTCTCTGC AGG (reversed) Intergenic
No off target data available for this crispr