ID: 1192179587

View in Genome Browser
Species Human (GRCh38)
Location X:68908188-68908210
Sequence AGTCTGAGTGGACCAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192179583_1192179587 23 Left 1192179583 X:68908142-68908164 CCCTGCATGTGTTATGCTAGGGT No data
Right 1192179587 X:68908188-68908210 AGTCTGAGTGGACCAAGAGATGG No data
1192179581_1192179587 24 Left 1192179581 X:68908141-68908163 CCCCTGCATGTGTTATGCTAGGG No data
Right 1192179587 X:68908188-68908210 AGTCTGAGTGGACCAAGAGATGG No data
1192179584_1192179587 22 Left 1192179584 X:68908143-68908165 CCTGCATGTGTTATGCTAGGGTC No data
Right 1192179587 X:68908188-68908210 AGTCTGAGTGGACCAAGAGATGG No data
1192179579_1192179587 25 Left 1192179579 X:68908140-68908162 CCCCCTGCATGTGTTATGCTAGG No data
Right 1192179587 X:68908188-68908210 AGTCTGAGTGGACCAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192179587 Original CRISPR AGTCTGAGTGGACCAAGAGA TGG Intergenic
No off target data available for this crispr