ID: 1192180004

View in Genome Browser
Species Human (GRCh38)
Location X:68910500-68910522
Sequence TCTCATGGGGTGATGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192179996_1192180004 -4 Left 1192179996 X:68910481-68910503 CCAGCTCCATGAAAAGAGGTCTC No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179985_1192180004 30 Left 1192179985 X:68910447-68910469 CCCCTCCCTCCTAGCTGCCTTTG No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179992_1192180004 13 Left 1192179992 X:68910464-68910486 CCTTTGAGGTTCCTGTCCCAGCT No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179990_1192180004 24 Left 1192179990 X:68910453-68910475 CCTCCTAGCTGCCTTTGAGGTTC No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179989_1192180004 25 Left 1192179989 X:68910452-68910474 CCCTCCTAGCTGCCTTTGAGGTT No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179987_1192180004 28 Left 1192179987 X:68910449-68910471 CCTCCCTCCTAGCTGCCTTTGAG No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179986_1192180004 29 Left 1192179986 X:68910448-68910470 CCCTCCCTCCTAGCTGCCTTTGA No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179999_1192180004 -10 Left 1192179999 X:68910487-68910509 CCATGAAAAGAGGTCTCATGGGG No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179995_1192180004 -3 Left 1192179995 X:68910480-68910502 CCCAGCTCCATGAAAAGAGGTCT No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179993_1192180004 2 Left 1192179993 X:68910475-68910497 CCTGTCCCAGCTCCATGAAAAGA No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data
1192179991_1192180004 21 Left 1192179991 X:68910456-68910478 CCTAGCTGCCTTTGAGGTTCCTG No data
Right 1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192180004 Original CRISPR TCTCATGGGGTGATGGGAAA GGG Intergenic
No off target data available for this crispr