ID: 1192180888

View in Genome Browser
Species Human (GRCh38)
Location X:68914848-68914870
Sequence GCTGCTGAGGAGCTGCGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192180878_1192180888 17 Left 1192180878 X:68914808-68914830 CCTGTGAGGATAGGAAGCAATTA No data
Right 1192180888 X:68914848-68914870 GCTGCTGAGGAGCTGCGAGTGGG No data
1192180882_1192180888 -10 Left 1192180882 X:68914835-68914857 CCACCCGGCCTAGGCTGCTGAGG No data
Right 1192180888 X:68914848-68914870 GCTGCTGAGGAGCTGCGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192180888 Original CRISPR GCTGCTGAGGAGCTGCGAGT GGG Intergenic
No off target data available for this crispr