ID: 1192183055

View in Genome Browser
Species Human (GRCh38)
Location X:68928395-68928417
Sequence ACCCGGGCCTTGTAGGTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192183055_1192183062 19 Left 1192183055 X:68928395-68928417 CCAATGACCTACAAGGCCCGGGT No data
Right 1192183062 X:68928437-68928459 TCTTCTGCCTCATCTCCAACCGG No data
1192183055_1192183058 -8 Left 1192183055 X:68928395-68928417 CCAATGACCTACAAGGCCCGGGT No data
Right 1192183058 X:68928410-68928432 GCCCGGGTGCTCTGGTGCCTAGG No data
1192183055_1192183063 20 Left 1192183055 X:68928395-68928417 CCAATGACCTACAAGGCCCGGGT No data
Right 1192183063 X:68928438-68928460 CTTCTGCCTCATCTCCAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192183055 Original CRISPR ACCCGGGCCTTGTAGGTCAT TGG (reversed) Intergenic
No off target data available for this crispr