ID: 1192183465

View in Genome Browser
Species Human (GRCh38)
Location X:68930546-68930568
Sequence CTCAGTAAGCTGTACACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192183461_1192183465 7 Left 1192183461 X:68930516-68930538 CCTTCAGCAAGAGGCTTGCCTTT No data
Right 1192183465 X:68930546-68930568 CTCAGTAAGCTGTACACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192183465 Original CRISPR CTCAGTAAGCTGTACACAGA GGG Intergenic
No off target data available for this crispr