ID: 1192184070

View in Genome Browser
Species Human (GRCh38)
Location X:68934665-68934687
Sequence GGGTCCTGAAAGACCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192184070_1192184081 22 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184081 X:68934710-68934732 GCCCATTGCCTTGCTAGGCCGGG No data
1192184070_1192184084 26 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184084 X:68934714-68934736 ATTGCCTTGCTAGGCCGGGCTGG No data
1192184070_1192184075 0 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184075 X:68934688-68934710 TTCTCTGCCTTCCTATCCTTGGG No data
1192184070_1192184079 17 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184079 X:68934705-68934727 CTTGGGCCCATTGCCTTGCTAGG No data
1192184070_1192184074 -1 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184074 X:68934687-68934709 CTTCTCTGCCTTCCTATCCTTGG No data
1192184070_1192184086 28 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184086 X:68934716-68934738 TGCCTTGCTAGGCCGGGCTGGGG No data
1192184070_1192184085 27 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184085 X:68934715-68934737 TTGCCTTGCTAGGCCGGGCTGGG No data
1192184070_1192184080 21 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192184070 Original CRISPR GGGTCCTGAAAGACCTCTGT GGG (reversed) Intergenic