ID: 1192184071

View in Genome Browser
Species Human (GRCh38)
Location X:68934666-68934688
Sequence AGGGTCCTGAAAGACCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192184071_1192184086 27 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184086 X:68934716-68934738 TGCCTTGCTAGGCCGGGCTGGGG No data
1192184071_1192184084 25 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184084 X:68934714-68934736 ATTGCCTTGCTAGGCCGGGCTGG No data
1192184071_1192184074 -2 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184074 X:68934687-68934709 CTTCTCTGCCTTCCTATCCTTGG No data
1192184071_1192184075 -1 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184075 X:68934688-68934710 TTCTCTGCCTTCCTATCCTTGGG No data
1192184071_1192184081 21 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184081 X:68934710-68934732 GCCCATTGCCTTGCTAGGCCGGG No data
1192184071_1192184080 20 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data
1192184071_1192184085 26 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184085 X:68934715-68934737 TTGCCTTGCTAGGCCGGGCTGGG No data
1192184071_1192184079 16 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184079 X:68934705-68934727 CTTGGGCCCATTGCCTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192184071 Original CRISPR AGGGTCCTGAAAGACCTCTG TGG (reversed) Intergenic
No off target data available for this crispr