ID: 1192184072

View in Genome Browser
Species Human (GRCh38)
Location X:68934685-68934707
Sequence AAGGATAGGAAGGCAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192184072_1192184085 7 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184085 X:68934715-68934737 TTGCCTTGCTAGGCCGGGCTGGG No data
1192184072_1192184086 8 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184086 X:68934716-68934738 TGCCTTGCTAGGCCGGGCTGGGG No data
1192184072_1192184081 2 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184081 X:68934710-68934732 GCCCATTGCCTTGCTAGGCCGGG No data
1192184072_1192184084 6 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184084 X:68934714-68934736 ATTGCCTTGCTAGGCCGGGCTGG No data
1192184072_1192184089 23 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184089 X:68934731-68934753 GGCTGGGGTAGCAGCCTTGTTGG No data
1192184072_1192184079 -3 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184079 X:68934705-68934727 CTTGGGCCCATTGCCTTGCTAGG No data
1192184072_1192184080 1 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data
1192184072_1192184090 24 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184090 X:68934732-68934754 GCTGGGGTAGCAGCCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192184072 Original CRISPR AAGGATAGGAAGGCAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr