ID: 1192184075

View in Genome Browser
Species Human (GRCh38)
Location X:68934688-68934710
Sequence TTCTCTGCCTTCCTATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192184069_1192184075 1 Left 1192184069 X:68934664-68934686 CCCCACAGAGGTCTTTCAGGACC No data
Right 1192184075 X:68934688-68934710 TTCTCTGCCTTCCTATCCTTGGG No data
1192184066_1192184075 27 Left 1192184066 X:68934638-68934660 CCAGTAGGCACAGAGCAGCTTCT No data
Right 1192184075 X:68934688-68934710 TTCTCTGCCTTCCTATCCTTGGG No data
1192184070_1192184075 0 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184075 X:68934688-68934710 TTCTCTGCCTTCCTATCCTTGGG No data
1192184071_1192184075 -1 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184075 X:68934688-68934710 TTCTCTGCCTTCCTATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192184075 Original CRISPR TTCTCTGCCTTCCTATCCTT GGG Intergenic
No off target data available for this crispr