ID: 1192184076

View in Genome Browser
Species Human (GRCh38)
Location X:68934695-68934717
Sequence CAATGGGCCCAAGGATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192184076_1192184084 -4 Left 1192184076 X:68934695-68934717 CCTTCCTATCCTTGGGCCCATTG No data
Right 1192184084 X:68934714-68934736 ATTGCCTTGCTAGGCCGGGCTGG No data
1192184076_1192184090 14 Left 1192184076 X:68934695-68934717 CCTTCCTATCCTTGGGCCCATTG No data
Right 1192184090 X:68934732-68934754 GCTGGGGTAGCAGCCTTGTTGGG No data
1192184076_1192184089 13 Left 1192184076 X:68934695-68934717 CCTTCCTATCCTTGGGCCCATTG No data
Right 1192184089 X:68934731-68934753 GGCTGGGGTAGCAGCCTTGTTGG No data
1192184076_1192184086 -2 Left 1192184076 X:68934695-68934717 CCTTCCTATCCTTGGGCCCATTG No data
Right 1192184086 X:68934716-68934738 TGCCTTGCTAGGCCGGGCTGGGG No data
1192184076_1192184085 -3 Left 1192184076 X:68934695-68934717 CCTTCCTATCCTTGGGCCCATTG No data
Right 1192184085 X:68934715-68934737 TTGCCTTGCTAGGCCGGGCTGGG No data
1192184076_1192184081 -8 Left 1192184076 X:68934695-68934717 CCTTCCTATCCTTGGGCCCATTG No data
Right 1192184081 X:68934710-68934732 GCCCATTGCCTTGCTAGGCCGGG No data
1192184076_1192184080 -9 Left 1192184076 X:68934695-68934717 CCTTCCTATCCTTGGGCCCATTG No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192184076 Original CRISPR CAATGGGCCCAAGGATAGGA AGG (reversed) Intergenic
No off target data available for this crispr