ID: 1192184080

View in Genome Browser
Species Human (GRCh38)
Location X:68934709-68934731
Sequence GGCCCATTGCCTTGCTAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192184076_1192184080 -9 Left 1192184076 X:68934695-68934717 CCTTCCTATCCTTGGGCCCATTG No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data
1192184071_1192184080 20 Left 1192184071 X:68934666-68934688 CCACAGAGGTCTTTCAGGACCCT No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data
1192184073_1192184080 0 Left 1192184073 X:68934686-68934708 CCTTCTCTGCCTTCCTATCCTTG No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data
1192184072_1192184080 1 Left 1192184072 X:68934685-68934707 CCCTTCTCTGCCTTCCTATCCTT No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data
1192184069_1192184080 22 Left 1192184069 X:68934664-68934686 CCCCACAGAGGTCTTTCAGGACC No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data
1192184070_1192184080 21 Left 1192184070 X:68934665-68934687 CCCACAGAGGTCTTTCAGGACCC No data
Right 1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192184080 Original CRISPR GGCCCATTGCCTTGCTAGGC CGG Intergenic
No off target data available for this crispr