ID: 1192185774

View in Genome Browser
Species Human (GRCh38)
Location X:68946005-68946027
Sequence GGTTGAGGAATGGCGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192185774_1192185782 30 Left 1192185774 X:68946005-68946027 CCGGCTGCCGCCATTCCTCAACC No data
Right 1192185782 X:68946058-68946080 GTTTCCTGCCATTCCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192185774 Original CRISPR GGTTGAGGAATGGCGGCAGC CGG (reversed) Intergenic
No off target data available for this crispr