ID: 1192186736

View in Genome Browser
Species Human (GRCh38)
Location X:68952206-68952228
Sequence CGTCCACCTGGAACTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192186736_1192186745 8 Left 1192186736 X:68952206-68952228 CCAGCTGGAGTTCCAGGTGGACG No data
Right 1192186745 X:68952237-68952259 GCGGGCCCTGCACTGTGGGCTGG No data
1192186736_1192186743 3 Left 1192186736 X:68952206-68952228 CCAGCTGGAGTTCCAGGTGGACG No data
Right 1192186743 X:68952232-68952254 GCTTGGCGGGCCCTGCACTGTGG No data
1192186736_1192186751 27 Left 1192186736 X:68952206-68952228 CCAGCTGGAGTTCCAGGTGGACG No data
Right 1192186751 X:68952256-68952278 CTGGATGGCCCCGCCGGCCTGGG No data
1192186736_1192186749 21 Left 1192186736 X:68952206-68952228 CCAGCTGGAGTTCCAGGTGGACG No data
Right 1192186749 X:68952250-68952272 TGTGGGCTGGATGGCCCCGCCGG No data
1192186736_1192186742 -10 Left 1192186736 X:68952206-68952228 CCAGCTGGAGTTCCAGGTGGACG No data
Right 1192186742 X:68952219-68952241 CAGGTGGACGTGGGCTTGGCGGG No data
1192186736_1192186744 4 Left 1192186736 X:68952206-68952228 CCAGCTGGAGTTCCAGGTGGACG No data
Right 1192186744 X:68952233-68952255 CTTGGCGGGCCCTGCACTGTGGG No data
1192186736_1192186750 26 Left 1192186736 X:68952206-68952228 CCAGCTGGAGTTCCAGGTGGACG No data
Right 1192186750 X:68952255-68952277 GCTGGATGGCCCCGCCGGCCTGG No data
1192186736_1192186746 12 Left 1192186736 X:68952206-68952228 CCAGCTGGAGTTCCAGGTGGACG No data
Right 1192186746 X:68952241-68952263 GCCCTGCACTGTGGGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192186736 Original CRISPR CGTCCACCTGGAACTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr