ID: 1192191331

View in Genome Browser
Species Human (GRCh38)
Location X:68993105-68993127
Sequence TCCTGTAAGTCCTACATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192191331_1192191335 1 Left 1192191331 X:68993105-68993127 CCTGTCATGTAGGACTTACAGGA No data
Right 1192191335 X:68993129-68993151 TTCCTGGGTAAAAGGAGCAGTGG No data
1192191331_1192191334 -7 Left 1192191331 X:68993105-68993127 CCTGTCATGTAGGACTTACAGGA No data
Right 1192191334 X:68993121-68993143 TACAGGACTTCCTGGGTAAAAGG No data
1192191331_1192191338 7 Left 1192191331 X:68993105-68993127 CCTGTCATGTAGGACTTACAGGA No data
Right 1192191338 X:68993135-68993157 GGTAAAAGGAGCAGTGGGAGAGG No data
1192191331_1192191336 2 Left 1192191331 X:68993105-68993127 CCTGTCATGTAGGACTTACAGGA No data
Right 1192191336 X:68993130-68993152 TCCTGGGTAAAAGGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192191331 Original CRISPR TCCTGTAAGTCCTACATGAC AGG (reversed) Intergenic
No off target data available for this crispr