ID: 1192194538

View in Genome Browser
Species Human (GRCh38)
Location X:69019432-69019454
Sequence GTGGTGAAGGACATGATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192194538_1192194544 13 Left 1192194538 X:69019432-69019454 CCAGTTATCATGTCCTTCACCAC No data
Right 1192194544 X:69019468-69019490 CTTCAGCCAAGCCACACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192194538 Original CRISPR GTGGTGAAGGACATGATAAC TGG (reversed) Intergenic
No off target data available for this crispr