ID: 1192194829

View in Genome Browser
Species Human (GRCh38)
Location X:69021283-69021305
Sequence TATAACCTGTAGCAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192194829_1192194840 24 Left 1192194829 X:69021283-69021305 CCTCCCTCCTGCTACAGGTTATA No data
Right 1192194840 X:69021330-69021352 CACACACCTGCCGCAGGCCTGGG No data
1192194829_1192194839 23 Left 1192194829 X:69021283-69021305 CCTCCCTCCTGCTACAGGTTATA No data
Right 1192194839 X:69021329-69021351 ACACACACCTGCCGCAGGCCTGG No data
1192194829_1192194838 18 Left 1192194829 X:69021283-69021305 CCTCCCTCCTGCTACAGGTTATA No data
Right 1192194838 X:69021324-69021346 CCAACACACACACCTGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192194829 Original CRISPR TATAACCTGTAGCAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr