ID: 1192194990

View in Genome Browser
Species Human (GRCh38)
Location X:69022051-69022073
Sequence TTTCCCTCCCTAATTTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192194986_1192194990 -9 Left 1192194986 X:69022037-69022059 CCTGGAGAGAAGTCTTTCCCTCC No data
Right 1192194990 X:69022051-69022073 TTTCCCTCCCTAATTTGTGGGGG No data
1192194985_1192194990 -6 Left 1192194985 X:69022034-69022056 CCACCTGGAGAGAAGTCTTTCCC No data
Right 1192194990 X:69022051-69022073 TTTCCCTCCCTAATTTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192194990 Original CRISPR TTTCCCTCCCTAATTTGTGG GGG Intergenic
No off target data available for this crispr