ID: 1192196812

View in Genome Browser
Species Human (GRCh38)
Location X:69034097-69034119
Sequence TGCCATGGCAATGGCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192196812_1192196817 -8 Left 1192196812 X:69034097-69034119 CCTGGCAGGCCATTGCCATGGCA No data
Right 1192196817 X:69034112-69034134 CCATGGCAGCCAGGGATTGCTGG No data
1192196812_1192196818 -7 Left 1192196812 X:69034097-69034119 CCTGGCAGGCCATTGCCATGGCA No data
Right 1192196818 X:69034113-69034135 CATGGCAGCCAGGGATTGCTGGG No data
1192196812_1192196822 5 Left 1192196812 X:69034097-69034119 CCTGGCAGGCCATTGCCATGGCA No data
Right 1192196822 X:69034125-69034147 GGATTGCTGGGAGGAGGAGCAGG No data
1192196812_1192196824 20 Left 1192196812 X:69034097-69034119 CCTGGCAGGCCATTGCCATGGCA No data
Right 1192196824 X:69034140-69034162 GGAGCAGGAGAGGAGCGACCCGG No data
1192196812_1192196825 21 Left 1192196812 X:69034097-69034119 CCTGGCAGGCCATTGCCATGGCA No data
Right 1192196825 X:69034141-69034163 GAGCAGGAGAGGAGCGACCCGGG No data
1192196812_1192196819 -4 Left 1192196812 X:69034097-69034119 CCTGGCAGGCCATTGCCATGGCA No data
Right 1192196819 X:69034116-69034138 GGCAGCCAGGGATTGCTGGGAGG No data
1192196812_1192196823 10 Left 1192196812 X:69034097-69034119 CCTGGCAGGCCATTGCCATGGCA No data
Right 1192196823 X:69034130-69034152 GCTGGGAGGAGGAGCAGGAGAGG No data
1192196812_1192196820 -1 Left 1192196812 X:69034097-69034119 CCTGGCAGGCCATTGCCATGGCA No data
Right 1192196820 X:69034119-69034141 AGCCAGGGATTGCTGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192196812 Original CRISPR TGCCATGGCAATGGCCTGCC AGG (reversed) Intergenic
No off target data available for this crispr