ID: 1192197037

View in Genome Browser
Species Human (GRCh38)
Location X:69035285-69035307
Sequence GTCTTTTTCTTAAGAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192197037_1192197040 3 Left 1192197037 X:69035285-69035307 CCCTTTGTTCTTAAGAAAAAGAC No data
Right 1192197040 X:69035311-69035333 ACTCCTGACCACAAATTACAGGG No data
1192197037_1192197039 2 Left 1192197037 X:69035285-69035307 CCCTTTGTTCTTAAGAAAAAGAC No data
Right 1192197039 X:69035310-69035332 GACTCCTGACCACAAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192197037 Original CRISPR GTCTTTTTCTTAAGAACAAA GGG (reversed) Intergenic
No off target data available for this crispr