ID: 1192197430

View in Genome Browser
Species Human (GRCh38)
Location X:69037969-69037991
Sequence GTCCCCTGCCACTGCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192197430_1192197437 14 Left 1192197430 X:69037969-69037991 CCCACCCAGCAGTGGCAGGGGAC No data
Right 1192197437 X:69038006-69038028 AGCACACTGGTCTTGATGTTTGG No data
1192197430_1192197436 1 Left 1192197430 X:69037969-69037991 CCCACCCAGCAGTGGCAGGGGAC No data
Right 1192197436 X:69037993-69038015 GGGCTTAAAGAGCAGCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192197430 Original CRISPR GTCCCCTGCCACTGCTGGGT GGG (reversed) Intergenic
No off target data available for this crispr