ID: 1192198465

View in Genome Browser
Species Human (GRCh38)
Location X:69048132-69048154
Sequence CATAGACACCATTTTAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192198465_1192198468 -7 Left 1192198465 X:69048132-69048154 CCAACTTTAAAATGGTGTCTATG No data
Right 1192198468 X:69048148-69048170 GTCTATGGAGTGTGGAGCAAAGG No data
1192198465_1192198471 28 Left 1192198465 X:69048132-69048154 CCAACTTTAAAATGGTGTCTATG No data
Right 1192198471 X:69048183-69048205 GTCTGAGCGGTAGAATTAACTGG No data
1192198465_1192198469 -4 Left 1192198465 X:69048132-69048154 CCAACTTTAAAATGGTGTCTATG No data
Right 1192198469 X:69048151-69048173 TATGGAGTGTGGAGCAAAGGAGG No data
1192198465_1192198470 15 Left 1192198465 X:69048132-69048154 CCAACTTTAAAATGGTGTCTATG No data
Right 1192198470 X:69048170-69048192 GAGGACTAGTTGAGTCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192198465 Original CRISPR CATAGACACCATTTTAAAGT TGG (reversed) Intergenic
No off target data available for this crispr