ID: 1192200368

View in Genome Browser
Species Human (GRCh38)
Location X:69062721-69062743
Sequence CCTGTTCACCACACAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192200368_1192200380 23 Left 1192200368 X:69062721-69062743 CCCCAGCCTGTGTGGTGAACAGG No data
Right 1192200380 X:69062767-69062789 ACAGACAGGAGAATGGCTTGTGG No data
1192200368_1192200375 9 Left 1192200368 X:69062721-69062743 CCCCAGCCTGTGTGGTGAACAGG No data
Right 1192200375 X:69062753-69062775 ATCATCCCCACTTCACAGACAGG No data
1192200368_1192200379 16 Left 1192200368 X:69062721-69062743 CCCCAGCCTGTGTGGTGAACAGG No data
Right 1192200379 X:69062760-69062782 CCACTTCACAGACAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192200368 Original CRISPR CCTGTTCACCACACAGGCTG GGG (reversed) Intergenic
No off target data available for this crispr