ID: 1192201113

View in Genome Browser
Species Human (GRCh38)
Location X:69067339-69067361
Sequence CTGCAGTGGCAGCGGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192201113_1192201124 17 Left 1192201113 X:69067339-69067361 CCCTGGCCCCGCTGCCACTGCAG No data
Right 1192201124 X:69067379-69067401 CTGACCCTCTGGAAGAATCAGGG No data
1192201113_1192201121 6 Left 1192201113 X:69067339-69067361 CCCTGGCCCCGCTGCCACTGCAG No data
Right 1192201121 X:69067368-69067390 CCTCACTCCGACTGACCCTCTGG No data
1192201113_1192201123 16 Left 1192201113 X:69067339-69067361 CCCTGGCCCCGCTGCCACTGCAG No data
Right 1192201123 X:69067378-69067400 ACTGACCCTCTGGAAGAATCAGG No data
1192201113_1192201127 29 Left 1192201113 X:69067339-69067361 CCCTGGCCCCGCTGCCACTGCAG No data
Right 1192201127 X:69067391-69067413 AAGAATCAGGGATGAAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192201113 Original CRISPR CTGCAGTGGCAGCGGGGCCA GGG (reversed) Intergenic
No off target data available for this crispr