ID: 1192201772

View in Genome Browser
Species Human (GRCh38)
Location X:69070965-69070987
Sequence CAGCTCTGTCAGCATCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192201772_1192201781 26 Left 1192201772 X:69070965-69070987 CCCACCGGATGCTGACAGAGCTG No data
Right 1192201781 X:69071014-69071036 TCCTTATGAGTGGCCTAGCCAGG No data
1192201772_1192201779 16 Left 1192201772 X:69070965-69070987 CCCACCGGATGCTGACAGAGCTG No data
Right 1192201779 X:69071004-69071026 CGTGGCTCCTTCCTTATGAGTGG No data
1192201772_1192201783 30 Left 1192201772 X:69070965-69070987 CCCACCGGATGCTGACAGAGCTG No data
Right 1192201783 X:69071018-69071040 TATGAGTGGCCTAGCCAGGCAGG No data
1192201772_1192201775 -2 Left 1192201772 X:69070965-69070987 CCCACCGGATGCTGACAGAGCTG No data
Right 1192201775 X:69070986-69071008 TGCCTTCTCCAGCGTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192201772 Original CRISPR CAGCTCTGTCAGCATCCGGT GGG (reversed) Intergenic
No off target data available for this crispr