ID: 1192202418

View in Genome Browser
Species Human (GRCh38)
Location X:69074998-69075020
Sequence GCAGCCTGACTGGCTCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192202411_1192202418 13 Left 1192202411 X:69074962-69074984 CCCTCTGGTCTCAGGCCCTCTGT No data
Right 1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG No data
1192202408_1192202418 27 Left 1192202408 X:69074948-69074970 CCAGGTCATTCTTCCCCTCTGGT No data
Right 1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG No data
1192202415_1192202418 -3 Left 1192202415 X:69074978-69075000 CCTCTGTGCCTGCTGTTAAGGCA No data
Right 1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG No data
1192202414_1192202418 -2 Left 1192202414 X:69074977-69074999 CCCTCTGTGCCTGCTGTTAAGGC No data
Right 1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG No data
1192202412_1192202418 12 Left 1192202412 X:69074963-69074985 CCTCTGGTCTCAGGCCCTCTGTG No data
Right 1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG No data
1192202410_1192202418 14 Left 1192202410 X:69074961-69074983 CCCCTCTGGTCTCAGGCCCTCTG No data
Right 1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192202418 Original CRISPR GCAGCCTGACTGGCTCAAAC TGG Intergenic
No off target data available for this crispr