ID: 1192203497

View in Genome Browser
Species Human (GRCh38)
Location X:69081849-69081871
Sequence GGGTGCAGGGGGAGTAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203497_1192203502 -8 Left 1192203497 X:69081849-69081871 CCAGGGTTACTCCCCCTGCACCC No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203497_1192203516 27 Left 1192203497 X:69081849-69081871 CCAGGGTTACTCCCCCTGCACCC No data
Right 1192203516 X:69081899-69081921 GAAACTACCCCCTGTGGTGGTGG No data
1192203497_1192203509 5 Left 1192203497 X:69081849-69081871 CCAGGGTTACTCCCCCTGCACCC No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203497_1192203515 24 Left 1192203497 X:69081849-69081871 CCAGGGTTACTCCCCCTGCACCC No data
Right 1192203515 X:69081896-69081918 TGGGAAACTACCCCCTGTGGTGG No data
1192203497_1192203507 4 Left 1192203497 X:69081849-69081871 CCAGGGTTACTCCCCCTGCACCC No data
Right 1192203507 X:69081876-69081898 ACCCCCAGAGGCAGTGTCCATGG No data
1192203497_1192203514 21 Left 1192203497 X:69081849-69081871 CCAGGGTTACTCCCCCTGCACCC No data
Right 1192203514 X:69081893-69081915 CCATGGGAAACTACCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203497 Original CRISPR GGGTGCAGGGGGAGTAACCC TGG (reversed) Intergenic
No off target data available for this crispr