ID: 1192203499

View in Genome Browser
Species Human (GRCh38)
Location X:69081861-69081883
Sequence CTGGGGGTGGGCGGGTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203499_1192203517 20 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203499_1192203515 12 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203515 X:69081896-69081918 TGGGAAACTACCCCCTGTGGTGG No data
1192203499_1192203514 9 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203514 X:69081893-69081915 CCATGGGAAACTACCCCCTGTGG No data
1192203499_1192203522 23 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203499_1192203509 -7 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203499_1192203520 22 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203520 X:69081906-69081928 CCCCCTGTGGTGGTGGTTTGGGG No data
1192203499_1192203507 -8 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203507 X:69081876-69081898 ACCCCCAGAGGCAGTGTCCATGG No data
1192203499_1192203518 21 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203518 X:69081905-69081927 ACCCCCTGTGGTGGTGGTTTGGG No data
1192203499_1192203516 15 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203516 X:69081899-69081921 GAAACTACCCCCTGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203499 Original CRISPR CTGGGGGTGGGCGGGTGCAG GGG (reversed) Intergenic
No off target data available for this crispr