ID: 1192203501

View in Genome Browser
Species Human (GRCh38)
Location X:69081863-69081885
Sequence CTCTGGGGGTGGGCGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203501_1192203514 7 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203514 X:69081893-69081915 CCATGGGAAACTACCCCCTGTGG No data
1192203501_1192203517 18 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203501_1192203518 19 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203518 X:69081905-69081927 ACCCCCTGTGGTGGTGGTTTGGG No data
1192203501_1192203522 21 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203501_1192203515 10 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203515 X:69081896-69081918 TGGGAAACTACCCCCTGTGGTGG No data
1192203501_1192203507 -10 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203507 X:69081876-69081898 ACCCCCAGAGGCAGTGTCCATGG No data
1192203501_1192203509 -9 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203501_1192203520 20 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203520 X:69081906-69081928 CCCCCTGTGGTGGTGGTTTGGGG No data
1192203501_1192203516 13 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203516 X:69081899-69081921 GAAACTACCCCCTGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203501 Original CRISPR CTCTGGGGGTGGGCGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr