ID: 1192203502

View in Genome Browser
Species Human (GRCh38)
Location X:69081864-69081886
Sequence CTGCACCCGCCCACCCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203485_1192203502 29 Left 1192203485 X:69081812-69081834 CCCACGAGGCCAGTCCCCCACAA No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203490_1192203502 14 Left 1192203490 X:69081827-69081849 CCCCACAAAAGAAGCCTGGCTCC No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203486_1192203502 28 Left 1192203486 X:69081813-69081835 CCACGAGGCCAGTCCCCCACAAA No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203495_1192203502 0 Left 1192203495 X:69081841-69081863 CCTGGCTCCCAGGGTTACTCCCC No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203489_1192203502 15 Left 1192203489 X:69081826-69081848 CCCCCACAAAAGAAGCCTGGCTC No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203491_1192203502 13 Left 1192203491 X:69081828-69081850 CCCACAAAAGAAGCCTGGCTCCC No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203496_1192203502 -7 Left 1192203496 X:69081848-69081870 CCCAGGGTTACTCCCCCTGCACC No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203497_1192203502 -8 Left 1192203497 X:69081849-69081871 CCAGGGTTACTCCCCCTGCACCC No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203492_1192203502 12 Left 1192203492 X:69081829-69081851 CCACAAAAGAAGCCTGGCTCCCA No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data
1192203487_1192203502 20 Left 1192203487 X:69081821-69081843 CCAGTCCCCCACAAAAGAAGCCT No data
Right 1192203502 X:69081864-69081886 CTGCACCCGCCCACCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203502 Original CRISPR CTGCACCCGCCCACCCCCAG AGG Intergenic
No off target data available for this crispr