ID: 1192203506

View in Genome Browser
Species Human (GRCh38)
Location X:69081874-69081896
Sequence ATGGACACTGCCTCTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203506_1192203525 23 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203525 X:69081920-69081942 GGTTTGGGGGATGATGTTCATGG No data
1192203506_1192203517 7 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203506_1192203522 10 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203506_1192203520 9 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203520 X:69081906-69081928 CCCCCTGTGGTGGTGGTTTGGGG No data
1192203506_1192203514 -4 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203514 X:69081893-69081915 CCATGGGAAACTACCCCCTGTGG No data
1192203506_1192203515 -1 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203515 X:69081896-69081918 TGGGAAACTACCCCCTGTGGTGG No data
1192203506_1192203516 2 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203516 X:69081899-69081921 GAAACTACCCCCTGTGGTGGTGG No data
1192203506_1192203518 8 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203518 X:69081905-69081927 ACCCCCTGTGGTGGTGGTTTGGG No data
1192203506_1192203526 24 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203526 X:69081921-69081943 GTTTGGGGGATGATGTTCATGGG No data
1192203506_1192203527 25 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203506 Original CRISPR ATGGACACTGCCTCTGGGGG TGG (reversed) Intergenic
No off target data available for this crispr