ID: 1192203509

View in Genome Browser
Species Human (GRCh38)
Location X:69081877-69081899
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203499_1192203509 -7 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203497_1192203509 5 Left 1192203497 X:69081849-69081871 CCAGGGTTACTCCCCCTGCACCC No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203501_1192203509 -9 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203500_1192203509 -8 Left 1192203500 X:69081862-69081884 CCCTGCACCCGCCCACCCCCAGA No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203495_1192203509 13 Left 1192203495 X:69081841-69081863 CCTGGCTCCCAGGGTTACTCCCC No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203498_1192203509 -6 Left 1192203498 X:69081860-69081882 CCCCCTGCACCCGCCCACCCCCA No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203489_1192203509 28 Left 1192203489 X:69081826-69081848 CCCCCACAAAAGAAGCCTGGCTC No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203492_1192203509 25 Left 1192203492 X:69081829-69081851 CCACAAAAGAAGCCTGGCTCCCA No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203491_1192203509 26 Left 1192203491 X:69081828-69081850 CCCACAAAAGAAGCCTGGCTCCC No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203490_1192203509 27 Left 1192203490 X:69081827-69081849 CCCCACAAAAGAAGCCTGGCTCC No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
1192203496_1192203509 6 Left 1192203496 X:69081848-69081870 CCCAGGGTTACTCCCCCTGCACC No data
Right 1192203509 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203509 Original CRISPR CCCCCAGAGGCAGTGTCCAT GGG Intergenic
No off target data available for this crispr