ID: 1192203517

View in Genome Browser
Species Human (GRCh38)
Location X:69081904-69081926
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203501_1192203517 18 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203504_1192203517 11 Left 1192203504 X:69081870-69081892 CCGCCCACCCCCAGAGGCAGTGT No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203512_1192203517 1 Left 1192203512 X:69081880-69081902 CCAGAGGCAGTGTCCATGGGAAA No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203499_1192203517 20 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203511_1192203517 2 Left 1192203511 X:69081879-69081901 CCCAGAGGCAGTGTCCATGGGAA No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203500_1192203517 19 Left 1192203500 X:69081862-69081884 CCCTGCACCCGCCCACCCCCAGA No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203498_1192203517 21 Left 1192203498 X:69081860-69081882 CCCCCTGCACCCGCCCACCCCCA No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203506_1192203517 7 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203503_1192203517 12 Left 1192203503 X:69081869-69081891 CCCGCCCACCCCCAGAGGCAGTG No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203508_1192203517 4 Left 1192203508 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203505_1192203517 8 Left 1192203505 X:69081873-69081895 CCCACCCCCAGAGGCAGTGTCCA No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data
1192203510_1192203517 3 Left 1192203510 X:69081878-69081900 CCCCAGAGGCAGTGTCCATGGGA No data
Right 1192203517 X:69081904-69081926 TACCCCCTGTGGTGGTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203517 Original CRISPR TACCCCCTGTGGTGGTGGTT TGG Intergenic
No off target data available for this crispr