ID: 1192203522

View in Genome Browser
Species Human (GRCh38)
Location X:69081907-69081929
Sequence CCCCTGTGGTGGTGGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203498_1192203522 24 Left 1192203498 X:69081860-69081882 CCCCCTGCACCCGCCCACCCCCA No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203511_1192203522 5 Left 1192203511 X:69081879-69081901 CCCAGAGGCAGTGTCCATGGGAA No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203506_1192203522 10 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203504_1192203522 14 Left 1192203504 X:69081870-69081892 CCGCCCACCCCCAGAGGCAGTGT No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203510_1192203522 6 Left 1192203510 X:69081878-69081900 CCCCAGAGGCAGTGTCCATGGGA No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203508_1192203522 7 Left 1192203508 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203499_1192203522 23 Left 1192203499 X:69081861-69081883 CCCCTGCACCCGCCCACCCCCAG No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203501_1192203522 21 Left 1192203501 X:69081863-69081885 CCTGCACCCGCCCACCCCCAGAG No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203503_1192203522 15 Left 1192203503 X:69081869-69081891 CCCGCCCACCCCCAGAGGCAGTG No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203505_1192203522 11 Left 1192203505 X:69081873-69081895 CCCACCCCCAGAGGCAGTGTCCA No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203512_1192203522 4 Left 1192203512 X:69081880-69081902 CCAGAGGCAGTGTCCATGGGAAA No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203513_1192203522 -9 Left 1192203513 X:69081893-69081915 CCATGGGAAACTACCCCCTGTGG No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
1192203500_1192203522 22 Left 1192203500 X:69081862-69081884 CCCTGCACCCGCCCACCCCCAGA No data
Right 1192203522 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203522 Original CRISPR CCCCTGTGGTGGTGGTTTGG GGG Intergenic
No off target data available for this crispr