ID: 1192203527

View in Genome Browser
Species Human (GRCh38)
Location X:69081922-69081944
Sequence TTTGGGGGATGATGTTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192203523_1192203527 -9 Left 1192203523 X:69081908-69081930 CCCTGTGGTGGTGGTTTGGGGGA No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203505_1192203527 26 Left 1192203505 X:69081873-69081895 CCCACCCCCAGAGGCAGTGTCCA No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203504_1192203527 29 Left 1192203504 X:69081870-69081892 CCGCCCACCCCCAGAGGCAGTGT No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203508_1192203527 22 Left 1192203508 X:69081877-69081899 CCCCCAGAGGCAGTGTCCATGGG No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203506_1192203527 25 Left 1192203506 X:69081874-69081896 CCACCCCCAGAGGCAGTGTCCAT No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203512_1192203527 19 Left 1192203512 X:69081880-69081902 CCAGAGGCAGTGTCCATGGGAAA No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203519_1192203527 -7 Left 1192203519 X:69081906-69081928 CCCCCTGTGGTGGTGGTTTGGGG No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203503_1192203527 30 Left 1192203503 X:69081869-69081891 CCCGCCCACCCCCAGAGGCAGTG No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203521_1192203527 -8 Left 1192203521 X:69081907-69081929 CCCCTGTGGTGGTGGTTTGGGGG No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203524_1192203527 -10 Left 1192203524 X:69081909-69081931 CCTGTGGTGGTGGTTTGGGGGAT No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203511_1192203527 20 Left 1192203511 X:69081879-69081901 CCCAGAGGCAGTGTCCATGGGAA No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203513_1192203527 6 Left 1192203513 X:69081893-69081915 CCATGGGAAACTACCCCCTGTGG No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data
1192203510_1192203527 21 Left 1192203510 X:69081878-69081900 CCCCAGAGGCAGTGTCCATGGGA No data
Right 1192203527 X:69081922-69081944 TTTGGGGGATGATGTTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192203527 Original CRISPR TTTGGGGGATGATGTTCATG GGG Intergenic
No off target data available for this crispr