ID: 1192208791

View in Genome Browser
Species Human (GRCh38)
Location X:69113712-69113734
Sequence AAATTGCTTGATACAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192208789_1192208791 19 Left 1192208789 X:69113670-69113692 CCTACTTCACAGGGGGCATGGTG No data
Right 1192208791 X:69113712-69113734 AAATTGCTTGATACAATTTCTGG No data
1192208790_1192208791 -7 Left 1192208790 X:69113696-69113718 CCATGATAATGTGTGTAAATTGC No data
Right 1192208791 X:69113712-69113734 AAATTGCTTGATACAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192208791 Original CRISPR AAATTGCTTGATACAATTTC TGG Intergenic
No off target data available for this crispr