ID: 1192211229

View in Genome Browser
Species Human (GRCh38)
Location X:69129132-69129154
Sequence CAAGCACAGACTCAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192211229_1192211239 30 Left 1192211229 X:69129132-69129154 CCTCTCTCTTGAGTCTGTGCTTG No data
Right 1192211239 X:69129185-69129207 CTCTTTCCCCATGGGAGATGAGG No data
1192211229_1192211234 21 Left 1192211229 X:69129132-69129154 CCTCTCTCTTGAGTCTGTGCTTG No data
Right 1192211234 X:69129176-69129198 GCTCCCCAGCTCTTTCCCCATGG No data
1192211229_1192211232 -1 Left 1192211229 X:69129132-69129154 CCTCTCTCTTGAGTCTGTGCTTG No data
Right 1192211232 X:69129154-69129176 GGTCCTGGTGCTTAGCTGCGAGG No data
1192211229_1192211235 22 Left 1192211229 X:69129132-69129154 CCTCTCTCTTGAGTCTGTGCTTG No data
Right 1192211235 X:69129177-69129199 CTCCCCAGCTCTTTCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192211229 Original CRISPR CAAGCACAGACTCAAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr