ID: 1192211232

View in Genome Browser
Species Human (GRCh38)
Location X:69129154-69129176
Sequence GGTCCTGGTGCTTAGCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192211228_1192211232 4 Left 1192211228 X:69129127-69129149 CCTCTCCTCTCTCTTGAGTCTGT No data
Right 1192211232 X:69129154-69129176 GGTCCTGGTGCTTAGCTGCGAGG No data
1192211229_1192211232 -1 Left 1192211229 X:69129132-69129154 CCTCTCTCTTGAGTCTGTGCTTG No data
Right 1192211232 X:69129154-69129176 GGTCCTGGTGCTTAGCTGCGAGG No data
1192211227_1192211232 9 Left 1192211227 X:69129122-69129144 CCAGGCCTCTCCTCTCTCTTGAG No data
Right 1192211232 X:69129154-69129176 GGTCCTGGTGCTTAGCTGCGAGG No data
1192211225_1192211232 16 Left 1192211225 X:69129115-69129137 CCTGGGCCCAGGCCTCTCCTCTC No data
Right 1192211232 X:69129154-69129176 GGTCCTGGTGCTTAGCTGCGAGG No data
1192211226_1192211232 10 Left 1192211226 X:69129121-69129143 CCCAGGCCTCTCCTCTCTCTTGA No data
Right 1192211232 X:69129154-69129176 GGTCCTGGTGCTTAGCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192211232 Original CRISPR GGTCCTGGTGCTTAGCTGCG AGG Intergenic
No off target data available for this crispr